Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21133
Trapped Gene
Dos (ENSMUSG00000035640)
Vector Insertion
Chr 10: 79600032 - 79600133
Public Clones not available
Private Clones OST340268 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000720849 (Chr10:79600033..79600132 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGACGACTTCGTGGGACAAT Chr10:79600051..79600070 61.53 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000720849 (Chr10:79600033..79600132 -)
Downstram Exon
ENSMUSE00000721143 (Chr10:79600033..79600132 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGACGACTTCGTGGGACAAT Chr10:79600051..79600070 61.53 50 GAAGTCGTCAGGGCAACAGT Chr10:79600039..79600058 60.31 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000665980 Chr10:79601831..79602112 GCTGCTCTCCCCATTCATAA Chr10:79601937..79601956 60.18 50
upstream ENSMUSE00000665989 Chr10:79601831..79602110 GCTGCTCTCCCCATTCATAA Chr10:79601937..79601956 60.18 50
upstream ENSMUSE00000720849 Chr10:79600033..79600132 TGACGACTTCGTGGGACAAT Chr10:79600051..79600070 61.53 50
upstream ENSMUSE00000721143 Chr10:79600033..79600132 TGACGACTTCGTGGGACAAT Chr10:79600051..79600070 61.53 50

*** Putative Vector Insertion (Chr 10: 79600032 - 79600133) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000610169 Chr10:79599788..79599927 AGAGCAGAAGAACGCCAGAC Chr10:79599803..79599822 59.75 55
downstream ENSMUSE00000665987 Chr10:79599788..79599927 AGAGCAGAAGAACGCCAGAC Chr10:79599803..79599822 59.75 55
downstream ENSMUSE00000610168 Chr10:79599619..79599683 GGTGCCGTTGTCCAGATAAG Chr10:79599610..79599629 60.52 55
downstream ENSMUSE00000665986 Chr10:79599619..79599683 GGTGCCGTTGTCCAGATAAG Chr10:79599610..79599629 60.52 55
downstream ENSMUSE00000610167 Chr10:79599435..79599488 CTGGGCGTTAAGGAAACAGA Chr10:79599419..79599438 60.24 50
downstream ENSMUSE00000610166 Chr10:79599095..79599239 CTAGGAAGCGCTCTGTTTCG Chr10:79599158..79599177 60.28 55
downstream ENSMUSE00000665985 Chr10:79599095..79599239 CTAGGAAGCGCTCTGTTTCG Chr10:79599158..79599177 60.28 55
downstream ENSMUSE00000311560 Chr10:79598120..79598291 GGTGATGGAAATCCCCTTCT Chr10:79598238..79598257 60.13 50
downstream ENSMUSE00000665984 Chr10:79598120..79598291 GGTGATGGAAATCCCCTTCT Chr10:79598238..79598257 60.13 50
downstream ENSMUSE00000311551 Chr10:79597863..79597991 AGGTTGAGGGGCTGATCTCT Chr10:79597867..79597886 60.22 55
downstream ENSMUSE00000665983 Chr10:79597863..79597991 AGGTTGAGGGGCTGATCTCT Chr10:79597867..79597886 60.22 55
downstream ENSMUSE00000311545 Chr10:79597306..79597513 CCGAGTGAAGAATTGCAAAA Chr10:79597384..79597403 58.89 40
downstream ENSMUSE00000665982 Chr10:79597306..79597513 CCGAGTGAAGAATTGCAAAA Chr10:79597384..79597403 58.89 40
downstream ENSMUSE00000392820 Chr10:79595750..79595930 CGCTGGCAATGTACTGAATG Chr10:79595804..79595823 60.28 50
downstream ENSMUSE00000337113 Chr10:79594033..79594996 CTTAGGCCTCAAAGCAGGTG Chr10:79594653..79594672 60.01 55
downstream ENSMUSE00000665981 Chr10:79593296..79594996 AGACAACACGACCAACCACA Chr10:79593299..79593318 60.05 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCCACTACCTAATCGCCTTG Chr10:79600071..79600091 59.73 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACTACCCGTGACTGGGAAAA Chr10:79600068..79600088 59.45 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035640