Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21138
Trapped Gene
Nedd4l (ENSMUSG00000024589)
Vector Insertion
Chr 18: 65080922 - 65157001
Public Clones (sanger) (sanger) E122B03 (ggtc) IST14238F9 (tigm) IST11376A4 (tigm)
Private Clones OST340188 (lexicon) OST327022 (lexicon) OST131040 (lexicon) OST64788 (lexicon)
OST62555 (lexicon) OST58347 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000444297 (Chr18:65080790..65080921 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGTTCATGTGGGGGACAAAG Chr18:65080810..65080829 59.82 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000444297 (Chr18:65080790..65080921 +)
Downstram Exon
ENSMUSE00000444290 (Chr18:65157002..65157075 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGTTCATGTGGGGGACAAAG Chr18:65080810..65080829 59.82 50 CTTCTTGGCGAGGTCAATTC Chr18:65157061..65157080 59.81 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000444297 Chr18:65080790..65080921 AGTTCATGTGGGGGACAAAG Chr18:65080810..65080829 59.82 50

*** Putative Vector Insertion (Chr 18: 65080922 - 65157001) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000444290 Chr18:65157002..65157075 CTTCTTGGCGAGGTCAATTC Chr18:65157061..65157080 59.81 50
downstream ENSMUSE00000625273 Chr18:65183548..65183643 CAGATTCCAGGCAGGAAAAC Chr18:65183646..65183665 59.67 50
downstream ENSMUSE00000572286 Chr18:65210696..65210826 GTGCTGTTGGACTGGTGTTG Chr18:65210790..65210809 60.2 55
downstream ENSMUSE00000490598 Chr18:65234378..65234459 No primer for this exon
downstream ENSMUSE00000625272 Chr18:65234378..65234459 No primer for this exon
downstream ENSMUSE00000404722 Chr18:65237352..65237390 CTTCATTCCACTTTGGGTTCA Chr18:65237378..65237398 59.96 42.86
downstream ENSMUSE00000625271 Chr18:65237352..65237390 CTTCATTCCACTTTGGGTTCA Chr18:65237378..65237398 59.96 42.86
downstream ENSMUSE00000444257 Chr18:65239672..65239725 GGAGCCTGTGATTAGATGGATT Chr18:65239697..65239718 59.45 45.46
downstream ENSMUSE00000625270 Chr18:65239672..65239725 GGAGCCTGTGATTAGATGGATT Chr18:65239697..65239718 59.45 45.46
downstream ENSMUSE00000403425 Chr18:65303450..65303500 No primer for this exon
downstream ENSMUSE00000625269 Chr18:65303450..65303500 No primer for this exon
downstream ENSMUSE00000444212 Chr18:65314910..65314971 TAGGGTCTCTCCATGGTTGG Chr18:65314941..65314960 59.92 55
downstream ENSMUSE00000572288 Chr18:65314910..65314971 TAGGGTCTCTCCATGGTTGG Chr18:65314941..65314960 59.92 55
downstream ENSMUSE00000143543 Chr18:65315300..65315402 TCTGCTCGCTGTTTTCTTCA Chr18:65315391..65315410 59.86 45
downstream ENSMUSE00000143550 Chr18:65317499..65317665 AGTTCGGCCTAAATTGTCCA Chr18:65317615..65317634 59.57 45
downstream ENSMUSE00000143546 Chr18:65321169..65321304 TCACTAATGTGCCTCCGAGA Chr18:65321261..65321280 59.39 50
downstream ENSMUSE00000318921 Chr18:65322649..65322825 AACTGAACTGTTCCCCGTTG Chr18:65322820..65322839 60.01 50
downstream ENSMUSE00000318885 Chr18:65325226..65325300 CAACCGTGTCGGTAACACTG Chr18:65325280..65325299 60.06 55
downstream ENSMUSE00000318861 Chr18:65327168..65327227 ACCCGTGACAGTTGACGAAC Chr18:65327215..65327234 61.03 55
downstream ENSMUSE00000143539 Chr18:65331929..65332060 TTCTTTCTTCCCAGCCTGAA Chr18:65331989..65332008 59.93 45
downstream ENSMUSE00000143557 Chr18:65332570..65332689 CTCCAGTGGGGCAGATAAAG Chr18:65332692..65332711 59.69 55
downstream ENSMUSE00000143561 Chr18:65333699..65333896 GTTGGGGGCTATCCTCATCT Chr18:65333854..65333873 60.29 55
downstream ENSMUSE00000143554 Chr18:65338573..65338650 TGGAAATTTCAACCGTGGAT Chr18:65338599..65338618 60.17 40
downstream ENSMUSE00000143558 Chr18:65340982..65341036 TCCAAGTGGATCCTCTCTTCC Chr18:65341012..65341032 60.58 52.38
downstream ENSMUSE00000143542 Chr18:65345980..65346038 TGATGGCTGGGTTCTGTAGTC Chr18:65346032..65346052 60.13 52.38
downstream ENSMUSE00000143553 Chr18:65351091..65351156 No primer for this exon
downstream ENSMUSE00000318699 Chr18:65352730..65352959 CCACAGCCTAGCCTTTAGGA Chr18:65352846..65352865 59.47 55
downstream ENSMUSE00000143545 Chr18:65354714..65354835 CTAGGCCAGCAACTCTTCCA Chr18:65354811..65354830 60.53 55
downstream ENSMUSE00000472197 Chr18:65355569..65355639 TGTCGTTCAGCGTTATCTGC Chr18:65355631..65355650 60.02 50
downstream ENSMUSE00000572285 Chr18:65358285..65358380 CTGCCCAAAGTTCTCTTCGT Chr18:65358383..65358402 59.47 50
downstream ENSMUSE00000347968 Chr18:65363530..65363603 GGGCTTCAGATCCACTTGGT Chr18:65363556..65363575 61.43 55
downstream ENSMUSE00000318611 Chr18:65365287..65365347 TTCTGGACCCTGTTCACAAA Chr18:65365328..65365347 59.11 45
downstream ENSMUSE00000572284 Chr18:65367703..65367762 No primer for this exon
downstream ENSMUSE00000143541 Chr18:65368046..65368153 TGCTGTCTCCAGTCGTTCAC Chr18:65368098..65368117 60.03 55
downstream ENSMUSE00000143555 Chr18:65369307..65369403 AGTTCGGCAAATCCATTCAT Chr18:65369401..65369420 59.39 40
downstream ENSMUSE00000143548 Chr18:65369917..65369989 TGGGTAGTTTTTCGGGACTG Chr18:65369979..65369998 59.96 50
downstream ENSMUSE00000625268 Chr18:65372438..65372961 ATCAGTGTACACGGCAACCA Chr18:65372766..65372785 60.03 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGAGGGCTGTGGTGACTTC Chr18:65086903..65086923 59.31 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGAGGGCTGTGGTGACTTC Chr18:65086903..65086923 59.31 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024589