Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21140
Trapped Gene
Elk4 (ENSMUSG00000026436)
Vector Insertion
Chr 1: 133909812 - 133910959
Public Clones not available
Private Clones OST340137 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000159045 (Chr1:133909603..133909811 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GATTGATCCCTCCACGTCAG Chr1:133909681..133909700 60.47 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000159045 (Chr1:133909603..133909811 +)
Downstram Exon
ENSMUSE00000159046 (Chr1:133910960..133911175 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GATTGATCCCTCCACGTCAG Chr1:133909681..133909700 60.47 55 CCTGCAGAAGCTTGAACTCC Chr1:133911083..133911102 60.13 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000691445 Chr1:133904184..133904517 GGTCTTTGAGGTCCGAGTGT Chr1:133904434..133904453 59.15 55
upstream ENSMUSE00000159043 Chr1:133904453..133904517 No primer for this exon
upstream ENSMUSE00000159045 Chr1:133909603..133909811 GATTGATCCCTCCACGTCAG Chr1:133909681..133909700 60.47 55

*** Putative Vector Insertion (Chr 1: 133909812 - 133910959) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000159046 Chr1:133910960..133911175 CCTGCAGAAGCTTGAACTCC Chr1:133911083..133911102 60.13 55
downstream ENSMUSE00000159041 Chr1:133914170..133915039 TGGTGTAAGAGACGCTGTCG Chr1:133915027..133915046 60.05 55
downstream ENSMUSE00000159042 Chr1:133915927..133916043 GGCTGAGAGTGCTCCAAAAG Chr1:133915993..133916012 60.13 55
downstream ENSMUSE00000353905 Chr1:133920130..133920469 AGTGGGAAAATCACGAGCAC Chr1:133920335..133920354 60.12 50
downstream ENSMUSE00000474558 Chr1:133920130..133920240 CCAGGCCTGACAGAGTGAAC Chr1:133920181..133920200 60.86 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGTGGTCTTCTAAGAGAATGTG Chr1:133909771..133909794 58.38 43.48 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGTGGTCTTCTAAGAGAATGTG Chr1:133909771..133909794 58.38 43.48 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026436