Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21142
Trapped Gene
Pls1 (ENSMUSG00000049493)
Vector Insertion
Chr 9: 95696286 - 95715664
Public Clones not available
Private Clones OST340101 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000720780 (Chr9:95715665..95715825 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACTGCCAGGCGCTAAGTAAG Chr9:95715679..95715698 59.68 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000720780 (Chr9:95715665..95715825 -)
Downstram Exon
ENSMUSE00000713021 (Chr9:95696181..95696285 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACTGCCAGGCGCTAAGTAAG Chr9:95715679..95715698 59.68 55 TCAAGCTCCTCCCGAGAAAT Chr9:95696188..95696207 61.23 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000583628 Chr9:95745590..95745679 No primer for this exon
upstream ENSMUSE00000720780 Chr9:95715665..95715825 ACTGCCAGGCGCTAAGTAAG Chr9:95715679..95715698 59.68 55

*** Putative Vector Insertion (Chr 9: 95696286 - 95715664) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000583627 Chr9:95696181..95696285 TCAAGCTCCTCCCGAGAAAT Chr9:95696188..95696207 61.23 50
downstream ENSMUSE00000713021 Chr9:95696181..95696285 TCAAGCTCCTCCCGAGAAAT Chr9:95696188..95696207 61.23 50
downstream ENSMUSE00000634924 Chr9:95687352..95687515 CGACACGAACTCCTCAAAACT Chr9:95687330..95687350 59.39 47.62
downstream ENSMUSE00000634923 Chr9:95685909..95686038 GCAGTGATCCCTTCCCTTTT Chr9:95685940..95685959 60.44 50
downstream ENSMUSE00000721951 Chr9:95684600..95684651 No primer for this exon
downstream ENSMUSE00000634922 Chr9:95684519..95684651 GGTGGCTACAGTCTGCATCA Chr9:95684561..95684580 59.86 55
downstream ENSMUSE00000634921 Chr9:95682789..95682870 ATGGCTCTCTCGTCAATCGT Chr9:95682801..95682820 59.83 50
downstream ENSMUSE00000634920 Chr9:95677108..95677273 GAGGTCCTGAGCACCAATGT Chr9:95677177..95677196 60.12 55
downstream ENSMUSE00000634919 Chr9:95676885..95677027 CAGGTCCTCGCCATCTTTTA Chr9:95676971..95676990 60.21 50
downstream ENSMUSE00000634918 Chr9:95675727..95675822 ATCATCTCGGTCGCCTTTAG Chr9:95675741..95675760 59.29 50
downstream ENSMUSE00000634917 Chr9:95673937..95674132 CGCTTCAGGTCGTTTTTCTC Chr9:95674091..95674110 59.99 50
downstream ENSMUSE00000336706 Chr9:95669513..95669591 CAGTTGCGGAATGTCCTCTC Chr9:95669536..95669555 60.8 55
downstream ENSMUSE00000219492 Chr9:95666110..95666224 AAGATCACCAAAGCGTCTGC Chr9:95666176..95666195 60.41 50
downstream ENSMUSE00000219488 Chr9:95662353..95662486 GTGTTGCGTTCCCTTCATTT Chr9:95662365..95662384 59.98 45
downstream ENSMUSE00000219504 Chr9:95661732..95661855 GGGTCTGGTTGACCCATTTA Chr9:95661751..95661770 59.65 50
downstream ENSMUSE00000219487 Chr9:95655080..95655204 CATTTCTTGACGGACTGCAT Chr9:95655105..95655124 58.72 45
downstream ENSMUSE00000583618 Chr9:95654458..95654856 GTTTGGTGCGTACAGTGTGG Chr9:95654658..95654677 60.07 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCTTGCCTTTCCATCTGTTC Chr9:95700635..95700655 59.67 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCAATAACGTGACTGGGAAAAC Chr9:95703598..95703620 60.76 45.46 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000049493