Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21152
Trapped Gene
Zfp97 (ENSMUSG00000067034)
Vector Insertion
Chr 17: 17222915 - 17224207
Public Clones not available
Private Clones OST339824 (lexicon) OST212188 (lexicon) OST178321 (lexicon) OST152531 (lexicon)
OST149112 (lexicon) OST110844 (lexicon)
Severity of mutation (?) Insertion after 9% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000613608 (Chr17:17222854..17222914 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGAAAATTCTGGAAGACCCACT Chr17:17222891..17222912 59.98 40.91 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000613608 (Chr17:17222854..17222914 +)
Downstram Exon
ENSMUSE00000658214 (Chr17:17224208..17225028 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGAAAATTCTGGAAGACCCACT Chr17:17222891..17222912 59.98 40.91 TTTCTTGCAAAGGCTCCATC Chr17:17224291..17224310 60.33 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000703501 Chr17:17214126..17214155 No primer for this exon
upstream ENSMUSE00000703488 Chr17:17221711..17221730 No primer for this exon
upstream ENSMUSE00000703496 Chr17:17221711..17221730 No primer for this exon
upstream ENSMUSE00000703485 Chr17:17221953..17221959 No primer for this exon
upstream ENSMUSE00000703493 Chr17:17221953..17221959 No primer for this exon
upstream ENSMUSE00000578014 Chr17:17222485..17222611 CTCAGGAAGAATGGGCTTTG Chr17:17222522..17222541 59.81 50
upstream ENSMUSE00000658216 Chr17:17222485..17222611 CTCAGGAAGAATGGGCTTTG Chr17:17222522..17222541 59.81 50
upstream ENSMUSE00000613608 Chr17:17222854..17222914 TGAAAATTCTGGAAGACCCACT Chr17:17222891..17222912 59.98 40.91

*** Putative Vector Insertion (Chr 17: 17222915 - 17224207) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000577995 Chr17:17224208..17226592 CACTGCATTATCCGGGTTTT Chr17:17226481..17226500 59.82 45
downstream ENSMUSE00000658214 Chr17:17224208..17225028 TTTCTTGCAAAGGCTCCATC Chr17:17224291..17224310 60.33 45
downstream ENSMUSE00000658212 Chr17:17226206..17226593 CACTGCATTATCCGGGTTTT Chr17:17226481..17226500 59.82 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr17:17222966..17222986 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000067034