Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2117
Trapped Gene
Mphosph6 (ENSMUSG00000031843)
Vector Insertion
Chr 8: 120316677 - 120318480
Public Clones AG0454 (sanger) AG0441 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 53% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000320718 (Chr8:120318481..120318571 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTCAGGGGGTTTAATCCTGA Chr8:120318488..120318507 59.36 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000320718 (Chr8:120318481..120318571 -)
Downstram Exon
ENSMUSE00000213654 (Chr8:120316579..120316676 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTCAGGGGGTTTAATCCTGA Chr8:120318488..120318507 59.36 45 TCGACCTCTACCGTCTCGTC Chr8:120316584..120316603 60.41 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000320735 Chr8:120325752..120325829 TCGGAGCGCAAGACTAAGTT Chr8:120325777..120325796 60.15 50
upstream ENSMUSE00000320725 Chr8:120322944..120323056 CTGGACTCGGAAACCAAGAA Chr8:120323022..120323041 60.22 50
upstream ENSMUSE00000320718 Chr8:120318481..120318571 TTCAGGGGGTTTAATCCTGA Chr8:120318488..120318507 59.36 45

*** Putative Vector Insertion (Chr 8: 120316677 - 120318480) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000213654 Chr8:120316579..120316676 TCGACCTCTACCGTCTCGTC Chr8:120316584..120316603 60.41 60
downstream ENSMUSE00000320701 Chr8:120315545..120316218 ACCAGTACCGACGACAGGAG Chr8:120315988..120316007 60.17 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTGAATTAATCGCCTTGCAG Chr8:120318415..120318435 58.91 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAATCGTGACTGGGAAAACC Chr8:120318413..120318433 59.39 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031843