Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21185
Trapped Gene
Eif2b4 (ENSMUSG00000029145)
Vector Insertion
Chr 5: 31494662 - 31494954
Public Clones (ggtc) (ggtc) (ggtc)
Private Clones OST339253 (lexicon)
Severity of mutation (?) Insertion after 8% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000466506 (Chr5:31494955..31494998 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCGAGATCCGAGATGAAGACT Chr5:31494976..31494996 58.98 47.62 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000466506 (Chr5:31494955..31494998 -)
Downstram Exon
ENSMUSE00000270290 (Chr5:31494526..31494661 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCGAGATCCGAGATGAAGACT Chr5:31494976..31494996 58.98 47.62 GAGCCAATTTCTTGGTCTGC Chr5:31494530..31494549 59.82 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000341252 Chr5:31495366..31495466 GCGCTGTAGTGTGAGTGACC Chr5:31495426..31495445 59.5 60
upstream ENSMUSE00000699918 Chr5:31495193..31495381 GATGAACACTGGATCGCTGA Chr5:31495307..31495326 59.79 50
upstream ENSMUSE00000466506 Chr5:31494955..31494998 TCGAGATCCGAGATGAAGACT Chr5:31494976..31494996 58.98 47.62
upstream ENSMUSE00000699916 Chr5:31494955..31495387 GATGAACACTGGATCGCTGA Chr5:31495307..31495326 59.79 50

*** Putative Vector Insertion (Chr 5: 31494662 - 31494954) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000270290 Chr5:31494526..31494661 GAGCCAATTTCTTGGTCTGC Chr5:31494530..31494549 59.82 50
downstream ENSMUSE00000186168 Chr5:31493914..31494120 CGCGAAGTTCTGCCTTACTC Chr5:31494006..31494025 60.15 55
downstream ENSMUSE00000186164 Chr5:31493738..31493820 GGAGCCTCCTCAGAAGTGTG Chr5:31493739..31493758 59.99 60
downstream ENSMUSE00000186166 Chr5:31493522..31493613 TTGGATCCGTAATCCTTTCG Chr5:31493563..31493582 59.89 45
downstream ENSMUSE00000186167 Chr5:31493210..31493324 ACTGCAGACCGAGTCTCACC Chr5:31493253..31493272 60.47 60
downstream ENSMUSE00000186171 Chr5:31492955..31493031 CCCTGGAGAGTTCCTCACTG Chr5:31492964..31492983 59.83 60
downstream ENSMUSE00000270266 Chr5:31492732..31492834 ACTTGATGGCGTTGCACATA Chr5:31492760..31492779 60.14 45
downstream ENSMUSE00000270258 Chr5:31492254..31492381 AATCGTGAAATTGCCTGAGC Chr5:31492280..31492299 60.22 45
downstream ENSMUSE00000186160 Chr5:31491942..31492119 TAGGAGGCTGCAGGAATCAG Chr5:31491933..31491952 60.49 55
downstream ENSMUSE00000186165 Chr5:31490287..31490467 CTGTCCCTACCCGAGACATC Chr5:31490376..31490395 59.53 60
downstream ENSMUSE00000270237 Chr5:31489941..31490173 CTCGAAGAACAACAGGCACA Chr5:31489972..31489991 60.03 50
downstream ENSMUSE00000699917 Chr5:31489940..31490173 CTCGAAGAACAACAGGCACA Chr5:31489972..31489991 60.03 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAAACGTGACTGGGAAAACC Chr5:31494887..31494907 59.43 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 2 GCCTGTCTGGCTCACTCTGT Chr5:31495016..31495036 60.62 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000029145