Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21187
Trapped Gene
Manba (ENSMUSG00000028164)
Vector Insertion
Chr 3: 135230686 - 135233178
Public Clones D051H09 (ggtc) D186F07 (ggtc) D051H09 (ggtc) D186G08 (ggtc) D186E07 (ggtc)
D186F08 (ggtc) CMHD-GT_387H8-3 (cmhd) (cmhd) IST12326B5 (tigm) IST12326B5 (tigm)
IST12476H3 (tigm) IST10420A12 (tigm) IST11172E8 (tigm) IST14961H2 (tigm)
IST11231H8 (tigm)
Private Clones OST339196 (lexicon) OST68518 (lexicon)
Severity of mutation (?) Insertion after 92% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000242177 (Chr3:135230428..135230685 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGCCCAACCAACTACCACT Chr3:135230616..135230635 60.03 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000242177 (Chr3:135230428..135230685 +)
Downstram Exon
ENSMUSE00000414715 (Chr3:135233179..135234293 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGCCCAACCAACTACCACT Chr3:135230616..135230635 60.03 55 AGTCTTCTGGCCGTGCTTTA Chr3:135233641..135233660 60.01 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000242269 Chr3:135148578..135148821 AGCATGCATCTTCACCTGCT Chr3:135148642..135148661 60.98 50
upstream ENSMUSE00000242259 Chr3:135169873..135169967 GGACCTACAGCACGGAATTT Chr3:135169928..135169947 59.06 50
upstream ENSMUSE00000242249 Chr3:135173939..135174044 GACACGGTTGCAGAAATCCT Chr3:135173976..135173995 60.12 50
upstream ENSMUSE00000242240 Chr3:135174767..135174937 CACGTCAACTTCATCCGAAA Chr3:135174917..135174936 59.69 45
upstream ENSMUSE00000242234 Chr3:135180867..135180990 TGGATTACCTCACGTTTTTGC Chr3:135180961..135180981 59.99 42.86
upstream ENSMUSE00000242226 Chr3:135185956..135186131 AGCTCGAAGTCCGTTAGTGG Chr3:135186009..135186028 59.5 55
upstream ENSMUSE00000176937 Chr3:135187481..135187591 GGGAACCAGACTGGGTACAA Chr3:135187517..135187536 59.82 55
upstream ENSMUSE00000176926 Chr3:135205276..135205427 GAGGGCATAAAAGGGTCTCC Chr3:135205306..135205325 59.9 55
upstream ENSMUSE00000176931 Chr3:135207690..135207807 GTGGCATCTACGAGCAGGAT Chr3:135207752..135207771 60.25 55
upstream ENSMUSE00000446365 Chr3:135210514..135210600 TAGCCTCCGTGAGGAAAGAA Chr3:135210569..135210588 59.95 50
upstream ENSMUSE00000176940 Chr3:135212164..135212331 AGTGGCTCTCAGCGTGAACT Chr3:135212223..135212242 60.21 55
upstream ENSMUSE00000500705 Chr3:135214027..135214245 AGACAAGAGCCGTCCTTTCA Chr3:135214029..135214048 59.99 50
upstream ENSMUSE00000176942 Chr3:135217724..135217888 CTTACAACAGCCGCTTCTCC Chr3:135217746..135217765 60.01 55
upstream ENSMUSE00000414334 Chr3:135226169..135226313 AGCGAGATAGTGGACGGAAA Chr3:135226223..135226242 59.84 50
upstream ENSMUSE00000445781 Chr3:135229452..135229594 CGTTTCTTCGCTCCACTGTT Chr3:135229493..135229512 60.43 50
upstream ENSMUSE00000242177 Chr3:135230428..135230685 CAGCCCAACCAACTACCACT Chr3:135230616..135230635 60.03 55

*** Putative Vector Insertion (Chr 3: 135230686 - 135233178) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000414715 Chr3:135233179..135234293 AGTCTTCTGGCCGTGCTTTA Chr3:135233641..135233660 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGAGGCCAACATCACTGTAA Chr3:135230671..135230691 59.72 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGAGGCCAACATCACTGTAA Chr3:135230671..135230691 59.72 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028164