Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21206
Trapped Gene
Fibp (ENSMUSG00000024911)
Vector Insertion
Chr 19: 5461160 - 5461389
Public Clones not available
Private Clones OST338790 (lexicon)
Severity of mutation (?) Insertion after 26% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000146173 (Chr19:5460961..5461159 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGTACGCTCCGGAATCTTG Chr19:5460982..5461001 59.84 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000146173 (Chr19:5460961..5461159 +)
Downstram Exon
ENSMUSE00000146161 (Chr19:5461390..5461516 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGTACGCTCCGGAATCTTG Chr19:5460982..5461001 59.84 55 TTGGTACCCTTGGACAGCTT Chr19:5461458..5461477 59.59 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000393358 Chr19:5460637..5460778 GACATTTTCGTGGGGAACAC Chr19:5460709..5460728 60.22 50
upstream ENSMUSE00000146173 Chr19:5460961..5461159 GAGTACGCTCCGGAATCTTG Chr19:5460982..5461001 59.84 55

*** Putative Vector Insertion (Chr 19: 5461160 - 5461389) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000146161 Chr19:5461390..5461516 TTGGTACCCTTGGACAGCTT Chr19:5461458..5461477 59.59 50
downstream ENSMUSE00000146177 Chr19:5462532..5462632 TAACCGGTCAGAGAGGAGGA Chr19:5462630..5462649 59.8 55
downstream ENSMUSE00000146169 Chr19:5463171..5463325 CCTGTTTCAAAGCGGTTGTT Chr19:5463221..5463240 60.15 45
downstream ENSMUSE00000146171 Chr19:5463604..5463712 CTTGTCAGCCACGAGAACCT Chr19:5463692..5463711 60.44 55
downstream ENSMUSE00000146175 Chr19:5463787..5463850 AGAGAAGACACCCAGCTTTCC Chr19:5463831..5463851 59.87 52.38
downstream ENSMUSE00000146165 Chr19:5464129..5464215 TCTCCACGAGGTCCACAAAT Chr19:5464216..5464235 60.51 50
downstream ENSMUSE00000146179 Chr19:5464334..5464431 ACGCTGAATACTGGCTGAGG Chr19:5464409..5464428 60.42 55
downstream ENSMUSE00000339509 Chr19:5464925..5465051 AATCATGATAGAGGCGCAGAA Chr19:5464994..5465014 59.82 42.86

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000024911