Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21207
Trapped Gene
Agbl2 (ENSMUSG00000040812)
Vector Insertion
Chr 2: 90656532 - 90668266
Public Clones IST14623H4 (tigm) IST11942E5 (tigm) IST14327B7 (tigm) IST10579C12HMF2 (tigm)
IST10579C12 (tigm)
Private Clones OST338719 (lexicon) OST79968 (lexicon)
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000453954 (Chr2:90656421..90656531 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATCCTTCATGAGCACCAAGC Chr2:90656451..90656470 60.23 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000453954 (Chr2:90656421..90656531 +)
Downstram Exon
ENSMUSE00000453950 (Chr2:90668267..90668645 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATCCTTCATGAGCACCAAGC Chr2:90656451..90656470 60.23 50 CTTCCTCATCTGCCCAAAAG Chr2:90668413..90668432 59.81 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000643548 Chr2:90622884..90622917 AGGGTCCTCGCAGAAAACTC Chr2:90622892..90622911 60.77 55
upstream ENSMUSE00000454300 Chr2:90623395..90623533 GTGTTGGGCATCTGTTCTCA Chr2:90623428..90623447 59.68 50
upstream ENSMUSE00000687995 Chr2:90623718..90623830 CAGCTGGGTACGGTGCTACT Chr2:90623743..90623762 60.33 60
upstream ENSMUSE00000687991 Chr2:90623730..90623830 CAGCTGGGTACGGTGCTACT Chr2:90623743..90623762 60.33 60
upstream ENSMUSE00000410908 Chr2:90623733..90623830 CAGCTGGGTACGGTGCTACT Chr2:90623743..90623762 60.33 60
upstream ENSMUSE00000471382 Chr2:90624143..90624282 GTCCTGCTTGAGATGGCTTT Chr2:90624189..90624208 59.43 50
upstream ENSMUSE00000716640 Chr2:90624143..90624282 GTCCTGCTTGAGATGGCTTT Chr2:90624189..90624208 59.43 50
upstream ENSMUSE00000463586 Chr2:90624219..90624282 No primer for this exon
upstream ENSMUSE00000643545 Chr2:90629090..90629224 GCCCTCGGTACATGTTGAAT Chr2:90629144..90629163 59.82 50
upstream ENSMUSE00000643544 Chr2:90629936..90629989 CTGGGCATGCTCACATAGAC Chr2:90629957..90629976 59.27 55
upstream ENSMUSE00000643543 Chr2:90631617..90631802 CGAGAACCCCGAGAACTCTT Chr2:90631697..90631716 60.76 55
upstream ENSMUSE00000643542 Chr2:90634030..90634137 CCAACCTACAGGAAGCGAGA Chr2:90634061..90634080 60.39 55
upstream ENSMUSE00000643540 Chr2:90637593..90637746 GGCCGGACGACAATACTCTA Chr2:90637677..90637696 60.1 55
upstream ENSMUSE00000643539 Chr2:90641194..90641976 AAACCCAGATGGCGTGATAG Chr2:90641848..90641867 59.96 50
upstream ENSMUSE00000306553 Chr2:90643199..90643355 CCATGAGCGTGTCTTTCCTT Chr2:90643307..90643326 60.26 50
upstream ENSMUSE00000306534 Chr2:90645956..90646082 AGTCTACCTTTGGCGGGTCT Chr2:90646056..90646075 60.13 55
upstream ENSMUSE00000306526 Chr2:90647456..90647556 TGTGATCCTGACCAAACCAA Chr2:90647536..90647555 59.94 45
upstream ENSMUSE00000306520 Chr2:90648135..90648265 No primer for this exon
upstream ENSMUSE00000306512 Chr2:90650105..90650174 CCCTCCCATTCGTCTACTGA Chr2:90650138..90650157 60.06 55
upstream ENSMUSE00000306505 Chr2:90650798..90650920 AAAACAGCGGAATGAGCAGT Chr2:90650851..90650870 59.88 45
upstream ENSMUSE00000391823 Chr2:90651414..90651521 AGTGAAAACCCAAGGCTCAA Chr2:90651498..90651517 59.71 45
upstream ENSMUSE00000335716 Chr2:90653432..90653509 CCACTGACCAGCCCTAAGAA Chr2:90653474..90653493 60.25 55
upstream ENSMUSE00000687987 Chr2:90654280..90654294 No primer for this exon
upstream ENSMUSE00000687997 Chr2:90654280..90654426 CAAGTGCATAGCAGCCTCAC Chr2:90654360..90654379 59.62 55
upstream ENSMUSE00000643521 Chr2:90655497..90655670 CGTGTACCCATCCTTGCATA Chr2:90655634..90655653 59.42 50
upstream ENSMUSE00000687990 Chr2:90655497..90656388 TTGGGAATGTGCCATATGAA Chr2:90656170..90656189 59.74 40
upstream ENSMUSE00000453954 Chr2:90656421..90656531 ATCCTTCATGAGCACCAAGC Chr2:90656451..90656470 60.23 50

*** Putative Vector Insertion (Chr 2: 90656532 - 90668266) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000453950 Chr2:90668267..90668645 CTTCCTCATCTGCCCAAAAG Chr2:90668413..90668432 59.81 50
downstream ENSMUSE00000687994 Chr2:90671552..90671692 TCCTGGAAAGGCTGATTCTG Chr2:90671666..90671685 60.33 50
downstream ENSMUSE00000687993 Chr2:90673626..90673720 AGCTGCAGTGCTCCTCTCTG Chr2:90673715..90673734 61.05 60
downstream ENSMUSE00000687992 Chr2:90674145..90674576 GAATATGCTTGTCGCCCAAT Chr2:90674199..90674218 59.93 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCCCTGTCAGAATCCAGAGT Chr2:90656490..90656510 59.26 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCCCTGTCAGAATCCAGAGT Chr2:90656490..90656510 59.26 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040812