Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21223
Trapped Gene
1500011H22Rik (ENSMUSG00000029463)
Vector Insertion
Chr 5: 122814929 - 122816322
Public Clones not available
Private Clones OST337986 (lexicon)
Severity of mutation (?) Insertion after 84% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000189086 (Chr5:122816323..122816405 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AACAAGATGCAAGTCCCTGAA Chr5:122816361..122816381 59.73 42.86 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000189086 (Chr5:122816323..122816405 -)
Downstram Exon
ENSMUSE00000338169 (Chr5:122814595..122814928 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AACAAGATGCAAGTCCCTGAA Chr5:122816361..122816381 59.73 42.86 CATGGTCCACTCTTCCCTGT Chr5:122814714..122814733 59.96 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000221639 Chr5:122821892..122822330 TAGGGTGACAACCGAAGGTC Chr5:122822228..122822247 59.97 55
upstream ENSMUSE00000221631 Chr5:122820524..122820582 No primer for this exon
upstream ENSMUSE00000221626 Chr5:122819526..122819647 GTACGCACACATTGCCAAAC Chr5:122819603..122819622 60.04 50
upstream ENSMUSE00000221620 Chr5:122817608..122817737 TTCATCACGGGTCACAGAAG Chr5:122817612..122817631 59.68 50
upstream ENSMUSE00000189093 Chr5:122817357..122817528 GCTGGAGCACCTGAAATGAT Chr5:122817396..122817415 60.23 50
upstream ENSMUSE00000189086 Chr5:122816323..122816405 AACAAGATGCAAGTCCCTGAA Chr5:122816361..122816381 59.73 42.86

*** Putative Vector Insertion (Chr 5: 122814929 - 122816322) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000338169 Chr5:122814595..122814928 CATGGTCCACTCTTCCCTGT Chr5:122814714..122814733 59.96 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCAGGCAGACTGTTCTTGTTA Chr5:122816325..122816346 58.02 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCAGGCAGACTGTTCTTGTTA Chr5:122816325..122816346 58.02 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029463