Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21229
Trapped Gene
Zc3h7b (ENSMUSG00000022390)
Vector Insertion
Chr 15: 81598484 - 81599262
Public Clones not available
Private Clones OST337840 (lexicon)
Severity of mutation (?) Insertion after 2% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000680731 (Chr15:81598425..81598483 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000680731 (Chr15:81598425..81598483 +)
Downstram Exon
ENSMUSE00000253367 (Chr15:81599263..81599296 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TGCTTCAGGGGTAGTGTTGA Chr15:81599286..81599305 59.29 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000680732 Chr15:81575278..81575776 CAAAACAGAGGTCGGTCCAG Chr15:81575288..81575307 60.68 55
upstream ENSMUSE00000680731 Chr15:81598425..81598483 No primer for this exon

*** Putative Vector Insertion (Chr 15: 81598484 - 81599262) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000253367 Chr15:81599263..81599296 TGCTTCAGGGGTAGTGTTGA Chr15:81599286..81599305 59.29 50
downstream ENSMUSE00000253364 Chr15:81599414..81599611 CCAGAGCCTGCTTGTAGTCC Chr15:81599498..81599517 60.01 60
downstream ENSMUSE00000680740 Chr15:81599429..81599611 CCAGAGCCTGCTTGTAGTCC Chr15:81599498..81599517 60.01 60
downstream ENSMUSE00000253357 Chr15:81602168..81602326 CCCAAAGCCTTCTCACTGTC Chr15:81602214..81602233 59.84 55
downstream ENSMUSE00000473716 Chr15:81602858..81602938 AAGCTTCTGAGCCAGCTCCT Chr15:81602905..81602924 60.81 55
downstream ENSMUSE00000253339 Chr15:81603716..81603772 GCTGGAGCGCCATTACTAAG Chr15:81603759..81603778 60 55
downstream ENSMUSE00000253327 Chr15:81606236..81606278 TCCCAATCCGTTAGAAGTTCC Chr15:81606258..81606278 60.31 47.62
downstream ENSMUSE00000472488 Chr15:81606708..81606901 CCAGTTCTGGACCAAACACA Chr15:81606884..81606903 59.56 50
downstream ENSMUSE00000473550 Chr15:81607211..81607532 CTGACCCAAAGCTGTCAAGG Chr15:81607499..81607518 60.82 55
downstream ENSMUSE00000253296 Chr15:81608303..81608361 No primer for this exon
downstream ENSMUSE00000507748 Chr15:81609040..81609139 AGCCAGAGGGTTCTTGATGA Chr15:81609093..81609112 59.8 50
downstream ENSMUSE00000253275 Chr15:81609539..81609700 GAGGCCCTCACGGTAGGTAT Chr15:81609579..81609598 60.35 60
downstream ENSMUSE00000253265 Chr15:81610834..81611039 CCCCTAGAGGGTCAAAGAGC Chr15:81610968..81610987 60.2 60
downstream ENSMUSE00000680735 Chr15:81610834..81610874 TCCCCGTACTTACAGTCTTGC Chr15:81610869..81610889 59.25 52.38
downstream ENSMUSE00000253255 Chr15:81612389..81612489 TTGGTCCCTTTGCTGATGAT Chr15:81612435..81612454 60.46 45
downstream ENSMUSE00000253250 Chr15:81613455..81613636 TCCTGGAACTGACGGATCTT Chr15:81613520..81613539 59.65 50
downstream ENSMUSE00000622638 Chr15:81616312..81616397 No primer for this exon
downstream ENSMUSE00000680724 Chr15:81622362..81622495 TGACCGCACACAAACTTCAT Chr15:81622426..81622445 60.16 45
downstream ENSMUSE00000680723 Chr15:81622660..81622765 CTGTGGGAAGTTTCGAATGG Chr15:81622759..81622778 60.49 50
downstream ENSMUSE00000680722 Chr15:81622893..81623001 GTTCCCCACATACTGGCATT Chr15:81622943..81622962 59.68 50
downstream ENSMUSE00000680721 Chr15:81623210..81623343 GGCATCTGGATCTGCTTCTC Chr15:81623324..81623343 59.92 55
downstream ENSMUSE00000680720 Chr15:81623450..81623613 TGTCACAGAGTCGGAACTCG Chr15:81623615..81623634 60.02 55
downstream ENSMUSE00000680719 Chr15:81623931..81626699 TTGGACCCATTTAGGAGCAG Chr15:81624489..81624508 60.07 50
downstream ENSMUSE00000680733 Chr15:81625674..81625888 GTGCATGCCATGGTTATCAG Chr15:81625705..81625724 59.96 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCTTTTCCTCCTGGCTGTAA Chr15:81598518..81598538 59.31 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGCTGCAGTTCATCCAGTA Chr15:81598468..81598488 61.21 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022390