Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21238
Trapped Gene
1110021J02Rik (ENSMUSG00000024018)
Vector Insertion
Chr 17: 29841415 - 29842215
Public Clones not available
Private Clones OST337482 (lexicon) OST221345 (lexicon) OST184392 (lexicon)
Severity of mutation (?) Insertion after 69% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000137280 (Chr17:29842216..29842268 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCATGAACAAAGCCTCCAAG Chr17:29842220..29842239 58.85 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000137280 (Chr17:29842216..29842268 -)
Downstram Exon
ENSMUSE00000416965 (Chr17:29841315..29841414 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCATGAACAAAGCCTCCAAG Chr17:29842220..29842239 58.85 45 CGTGTTCTTCCGGTTCTCAT Chr17:29841349..29841368 60.11 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000233744 Chr17:29853879..29853939 AGAAGCGGGAGAATCTTGGT Chr17:29853891..29853910 60.21 50
upstream ENSMUSE00000700077 Chr17:29853879..29853956 AGAAGCGGGAGAATCTTGGT Chr17:29853891..29853910 60.21 50
upstream ENSMUSE00000233708 Chr17:29842434..29842528 TTGACGGGCTAGAGGAAAAG Chr17:29842508..29842527 59.45 50
upstream ENSMUSE00000137280 Chr17:29842216..29842268 TCATGAACAAAGCCTCCAAG Chr17:29842220..29842239 58.85 45

*** Putative Vector Insertion (Chr 17: 29841415 - 29842215) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000416965 Chr17:29841315..29841414 CGTGTTCTTCCGGTTCTCAT Chr17:29841349..29841368 60.11 50
downstream ENSMUSE00000700076 Chr17:29840279..29841414 CTGGAGATGGCTGACTCACA Chr17:29841274..29841293 59.98 55
downstream ENSMUSE00000657871 Chr17:29837173..29837197 AGGGTGAAGGAGGTGTATCG Chr17:29837155..29837174 59.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGGCACCTGGGAAGAATAA Chr17:29842161..29842181 60.07 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000024018