Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21243
Trapped Gene
Sec61g (ENSMUSG00000078974)
Vector Insertion
Chr 11: 16406476 - 16407982
Public Clones (sanger) IST11272C6 (tigm)
Private Clones OST337361 (lexicon) OST290114 (lexicon) OST236301 (lexicon) OST80537 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000681056 (Chr11:16407983..16408072 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGGGGAGGTGAAGAAACTG Chr11:16407986..16408005 59.69 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000681056 (Chr11:16407983..16408072 -)
Downstram Exon
ENSMUSE00000681063 (Chr11:16406376..16406475 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGGGGAGGTGAAGAAACTG Chr11:16407986..16408005 59.69 55 TAACCAGCCGAATTGAGTCC Chr11:16406381..16406400 60.07 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000681064 Chr11:16408107..16408487 AGCTGTAGCGCAGACACTCA Chr11:16408440..16408459 59.95 55
upstream ENSMUSE00000681058 Chr11:16408103..16408169 CTCAATCCGCCATCCAGTAA Chr11:16408103..16408122 60.99 50
upstream ENSMUSE00000681056 Chr11:16407983..16408072 CAGGGGAGGTGAAGAAACTG Chr11:16407986..16408005 59.69 55

*** Putative Vector Insertion (Chr 11: 16406476 - 16407982) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000681063 Chr11:16406376..16406475 TAACCAGCCGAATTGAGTCC Chr11:16406381..16406400 60.07 50
downstream ENSMUSE00000681061 Chr11:16404739..16404841 TTTCACGAAGAAGCCAATGA Chr11:16404749..16404768 59.4 40
downstream ENSMUSE00000681055 Chr11:16401654..16401810 AGCATTCAGGCAACGCTTTA Chr11:16401708..16401727 60.9 45
downstream ENSMUSE00000681057 Chr11:16401390..16401810 TTCATGGCTCTCAGGATGTG Chr11:16401412..16401431 59.79 50
downstream ENSMUSE00000681059 Chr11:16400533..16401810 GGGAAAGACGTTCACTTCCA Chr11:16400980..16400999 60.09 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCTAAGTGGGCGCGAGTAAT Chr11:16407927..16407947 59.87 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACCAGGGGAGGTGAAGAAAC Chr11:16407986..16408006 60.35 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TGGTAGGTAGGGGAAAGCTG Chr11:16408062..16408082 59.19 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TGGTAGGTAGGGGAAAGCTG Chr11:16408062..16408082 59.19 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000078974