Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21245
Trapped Gene
Sfrs10 (ENSMUSG00000022858)
Vector Insertion
Chr 16: 22246940 - 22247262
Public Clones not available
Private Clones OST337201 (lexicon) OST64373 (lexicon)
Severity of mutation (?) Insertion after 99% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000560931 (Chr16:22247263..22247336 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACAGGTCACGTTCTCGATCA Chr16:22247279..22247298 59.26 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000560931 (Chr16:22247263..22247336 -)
Downstram Exon
ENSMUSE00000702638 (Chr16:22246442..22246939 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACAGGTCACGTTCTCGATCA Chr16:22247279..22247298 59.26 50 CACACAGGCTTCGATCTTCA Chr16:22246561..22246580 59.98 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000644766 Chr16:22265814..22265994 GAGCTCCTCGCAAAAGTGTG Chr16:22265943..22265962 61.12 55
upstream ENSMUSE00000560946 Chr16:22255057..22255190 AATCTGCACGGCATACACCT Chr16:22255125..22255144 60.55 50
upstream ENSMUSE00000560944 Chr16:22254481..22254643 ATCTCGCTCGCATAGACGAT Chr16:22254573..22254592 59.97 50
upstream ENSMUSE00000560941 Chr16:22252680..22252868 CCTGACCCCAACTGTTGTCT Chr16:22252843..22252862 60 55
upstream ENSMUSE00000560939 Chr16:22250938..22251053 GATGGGCGTCGAATTAGAGT Chr16:22251004..22251023 59.15 50
upstream ENSMUSE00000560937 Chr16:22249123..22249206 GAGGGTACGATCGGGGTTAT Chr16:22249155..22249174 60.04 55
upstream ENSMUSE00000560933 Chr16:22248509..22248568 ATGGAGAGCAGCTCAAGACAG Chr16:22248524..22248544 59.76 52.38
upstream ENSMUSE00000560931 Chr16:22247263..22247336 ACAGGTCACGTTCTCGATCA Chr16:22247279..22247298 59.26 50

*** Putative Vector Insertion (Chr 16: 22246940 - 22247262) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000702638 Chr16:22246442..22246939 CACACAGGCTTCGATCTTCA Chr16:22246561..22246580 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr16:22247192..22247212 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCGATCACGATCCTACTCACC Chr16:22247263..22247284 60.09 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022858