Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21251
Trapped Gene
Morc3 (ENSMUSG00000039456)
Vector Insertion
Chr 16: 93873640 - 93875003
Public Clones not available
Private Clones OST337083 (lexicon)
Severity of mutation (?) Insertion after 95% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000244065 (Chr16:93873482..93873639 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCGAGGAGCCTGTCAGTTAT Chr16:93873606..93873625 59.31 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000244065 (Chr16:93873482..93873639 +)
Downstram Exon
ENSMUSE00000334632 (Chr16:93875004..93876317 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCGAGGAGCCTGTCAGTTAT Chr16:93873606..93873625 59.31 55 TATGATCCCAGGCCCATTTA Chr16:93876018..93876037 60.11 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000616643 Chr16:93832529..93832593 TGGCTTTGTAGCTCACTCAAGA Chr16:93832534..93832555 60.19 45.46
upstream ENSMUSE00000433413 Chr16:93841616..93841688 GTCATACCTGGCCGTTCAGT Chr16:93841650..93841669 60 55
upstream ENSMUSE00000422774 Chr16:93844439..93844571 CTGATAATGGCAACGGGATG Chr16:93844523..93844542 61.25 50
upstream ENSMUSE00000433402 Chr16:93845385..93845598 GTTGGATTGTACGGGAATGG Chr16:93845428..93845447 60.05 50
upstream ENSMUSE00000472782 Chr16:93847527..93847675 AGCAAGCCTAGCAGCAATTC Chr16:93847556..93847575 59.76 50
upstream ENSMUSE00000555436 Chr16:93849375..93849522 ATGAGACTGCAGGGAGGAAA Chr16:93849443..93849462 59.8 50
upstream ENSMUSE00000555430 Chr16:93853334..93853462 TTGCCTACATTGAACGTGATG Chr16:93853422..93853442 59.6 42.86
upstream ENSMUSE00000555428 Chr16:93854024..93854143 TTTTGGATTCAACTGCAGAAAT Chr16:93854044..93854065 58.74 31.82
upstream ENSMUSE00000555425 Chr16:93855661..93855758 ACATGGGTGTTGGAGTGGTT Chr16:93855668..93855687 60.13 50
upstream ENSMUSE00000555423 Chr16:93860738..93860842 TCCTGTAAACTTGCCAGTCG Chr16:93860813..93860832 58.92 50
upstream ENSMUSE00000555421 Chr16:93862659..93862781 CCAATAACCCTGACCCACAG Chr16:93862757..93862776 60.22 55
upstream ENSMUSE00000555419 Chr16:93862886..93862960 TGTGAAGTTCCGGAAGAACC Chr16:93862890..93862909 60.09 50
upstream ENSMUSE00000555417 Chr16:93865205..93865262 TCAGACAACCGGAAATCCTC Chr16:93865225..93865244 60.05 50
upstream ENSMUSE00000358240 Chr16:93866620..93866783 GAAGTCACGAGTCCCTTTGC Chr16:93866707..93866726 59.85 55
upstream ENSMUSE00000244070 Chr16:93870609..93871497 GAACGACAAGTGCGTGAAGA Chr16:93871191..93871210 60.03 50
upstream ENSMUSE00000244065 Chr16:93873482..93873639 CCGAGGAGCCTGTCAGTTAT Chr16:93873606..93873625 59.31 55

*** Putative Vector Insertion (Chr 16: 93873640 - 93875003) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000334632 Chr16:93875004..93876317 TATGATCCCAGGCCCATTTA Chr16:93876018..93876037 60.11 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACTTAATCGCCTTGCAGCAC Chr16:93873688..93873708 60.42 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCGAGGAGCCTGTCAGTTAT Chr16:93873607..93873627 59.31 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039456