Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21290
Trapped Gene
Gmeb2 (ENSMUSG00000038705)
Vector Insertion
Chr 2: 181012827 - 181022588
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
E112H11 (ggtc) (ggtc) D087H02 (ggtc) D123G10 (ggtc) (ggtc)
D053B11 (ggtc) (ggtc) D105H11 (ggtc) (ggtc) CMHD-GT_518C6-3 (cmhd) CMHD-GT_525H1-3 (cmhd)
IST10895H7 (tigm) IST14787F5 (tigm) IST12740C9 (tigm) IST14564G10 (tigm)
IST14603D10 (tigm) IST11095H3 (tigm) IST10916B8 (tigm) IST10039B1 (tigm)
Private Clones OST335907 (lexicon) OST258383 (lexicon) OST224314 (lexicon) OST179890 (lexicon)
OST173295 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000424497 (Chr2:181022589..181022671 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000424497 (Chr2:181022589..181022671 -)
Downstram Exon
ENSMUSE00000221742 (Chr2:181012654..181012826 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CCTCTACACCACTGCCATCA Chr2:181012675..181012694 59.7 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000424497 Chr2:181022589..181022671 No primer for this exon

*** Putative Vector Insertion (Chr 2: 181012827 - 181022588) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000221742 Chr2:181012654..181012826 CCTCTACACCACTGCCATCA Chr2:181012675..181012694 59.7 55
downstream ENSMUSE00000221731 Chr2:181000520..181000617 CTAACACGGCTTCCTTGAGC Chr2:181000498..181000517 60.01 55
downstream ENSMUSE00000221722 Chr2:180999686..180999813 AAGTTCTCCCCCTCTTCAGC Chr2:180999764..180999783 59.82 55
downstream ENSMUSE00000545717 Chr2:180995000..180995103 CTCCTTTGGGCTGATCACAT Chr2:180995052..180995071 60.07 50
downstream ENSMUSE00000221713 Chr2:180993689..180993846 GCTGCGGCAAGTATTAGAGC Chr2:180993755..180993774 60.15 55
downstream ENSMUSE00000221708 Chr2:180990577..180990648 AGTCACCAGGGTCCTCACAG Chr2:180990573..180990592 60.15 60
downstream ENSMUSE00000221761 Chr2:180990200..180990337 CAGTAAGCCCGCATCCTTTA Chr2:180990269..180990288 60.22 50
downstream ENSMUSE00000221754 Chr2:180989847..180989969 AGGTCCCGTGCATACTGTTC Chr2:180989830..180989849 60 55
downstream ENSMUSE00000396312 Chr2:180986156..180989128 AGGAGCCTAGGCACTCAACA Chr2:180987708..180987727 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTAATCGCCTTGCAGCACATC Chr2:181022517..181022538 63.08 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAAATACATCGTGACTGGGAAAA Chr2:181019523..181019546 59.76 34.78 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CCTGCATTTTTCACAGCCTA Chr2:181022675..181022695 58.92 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CAGACGTGACTGGGAAAACC Chr2:181016605..181016625 60.54 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038705