Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2131
Trapped Gene
Cbl (ENSMUSG00000034342)
Vector Insertion
Chr 9: 44009291 - 44041782
Public Clones AD0253 (sanger) XS0447 (sanger) (sanger) RRR695 (baygenomics) IST13253F7 (tigm)
IST14514G3 (tigm) IST14566H2 (tigm) IST10926H11 (tigm) IST14566H2 (tigm)
IST10926H11 (tigm) IST12592E7 (tigm)
Private Clones OST445466 (lexicon) OST386081 (lexicon)
Severity of mutation (?) Insertion after 7% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000536029 (Chr9:44041783..44042129 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACGGTGGACAAGAAGATGGT Chr9:44041811..44041830 59.43 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000536029 (Chr9:44041783..44042129 -)
Downstram Exon
ENSMUSE00000426061 (Chr9:44009043..44009290 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACGGTGGACAAGAAGATGGT Chr9:44041811..44041830 59.43 50 TTCTCCAAGCGTCTCCATCT Chr9:44009131..44009150 59.95 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000536029 Chr9:44041783..44042129 ACGGTGGACAAGAAGATGGT Chr9:44041811..44041830 59.43 50

*** Putative Vector Insertion (Chr 9: 44009291 - 44041782) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000426061 Chr9:44009043..44009290 TTCTCCAAGCGTCTCCATCT Chr9:44009131..44009150 59.95 50
downstream ENSMUSE00000265112 Chr9:43981336..43981482 AAGAGTCCGCTCGGAAAGAT Chr9:43981383..43981402 60.35 50
downstream ENSMUSE00000265085 Chr9:43977103..43977259 GAAAGCTCTTCCACGGGACT Chr9:43977212..43977231 60.77 55
downstream ENSMUSE00000265063 Chr9:43975293..43975414 CAGCAAGGCTGTTCCAATTT Chr9:43975353..43975372 60.25 45
downstream ENSMUSE00000536019 Chr9:43974536..43974673 ACAGCTCAGCCGAAAGATGT Chr9:43974630..43974649 60.02 50
downstream ENSMUSE00000265026 Chr9:43972885..43972972 TTTGATTTCGTCCATCAGGA Chr9:43972922..43972941 59.05 40
downstream ENSMUSE00000536014 Chr9:43972209..43972340 GTGTCCACAGGGCTCAATCT Chr9:43972220..43972239 60.12 55
downstream ENSMUSE00000264989 Chr9:43971422..43971625 ATTTCACATCGGCAAAAAGG Chr9:43971563..43971582 59.94 40
downstream ENSMUSE00000264966 Chr9:43967060..43967191 GGTCAAGTCTTGGTGGCACT Chr9:43967097..43967116 60.16 55
downstream ENSMUSE00000264933 Chr9:43966597..43966974 GCCTAGGGACATCTGCTCTG Chr9:43966607..43966626 59.97 60
downstream ENSMUSE00000264913 Chr9:43964699..43964793 AGTAAATGGCGTTGGCAGAC Chr9:43964690..43964709 60.14 50
downstream ENSMUSE00000264891 Chr9:43962273..43962413 GGCAGTTTTGGCATAGGAAG Chr9:43962368..43962387 59.71 50
downstream ENSMUSE00000264870 Chr9:43961844..43961941 GAGGCGCTGTTTTCTGCTAC Chr9:43961824..43961843 60.16 55
downstream ENSMUSE00000264845 Chr9:43960872..43961051 TCATCCTCGTTTTCGGATTC Chr9:43960966..43960985 60.01 45
downstream ENSMUSE00000414458 Chr9:43957345..43959820 CCAACACCATCACGCATTAG Chr9:43958815..43958834 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TATTAATCGCCTTGCAGCAC Chr9:44032714..44032734 58.94 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACGAGGCCTGAATTTTAGGAA Chr9:44032784..44032805 60.08 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 ACTAATCGCCTTGCAGCACA Chr9:44033061..44033081 61.9 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GTGTGTGGTCATGAGGATGG Chr9:44033149..44033169 59.8 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000034342