Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21322
Trapped Gene
Trim54 (ENSMUSG00000062077)
Vector Insertion
Chr 5: 31438415 - 31438542
Public Clones not available
Private Clones OST334295 (lexicon)
Severity of mutation (?) Insertion after 55% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000516747 (Chr5:31438416..31438649 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCCAGTACGGAGACCACTTG Chr5:31438558..31438577 60.71 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000516747 (Chr5:31438416..31438649 +)
Downstram Exon
ENSMUSE00000700032 (Chr5:31438416..31438541 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCCAGTACGGAGACCACTTG Chr5:31438558..31438577 60.71 60 GGGTCTCGAACCTCTGGTTT Chr5:31438467..31438486 60.49 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000271057 Chr5:31419085..31419450 ACTTCACGGTGGGTTTCAAG Chr5:31419287..31419306 60.01 50
upstream ENSMUSE00000700030 Chr5:31419107..31419450 ACTTCACGGTGGGTTTCAAG Chr5:31419287..31419306 60.01 50
upstream ENSMUSE00000271047 Chr5:31433415..31433587 CGGAACCTGCTAGTGGAGAA Chr5:31433535..31433554 60.39 55
upstream ENSMUSE00000271038 Chr5:31434361..31434532 CACCATTTACAAACGCCAGA Chr5:31434511..31434530 59.58 45
upstream ENSMUSE00000271026 Chr5:31436423..31436518 ATCACCCAGATGGAGGAGGT Chr5:31436483..31436502 60.74 55

*** Putative Vector Insertion (Chr 5: 31438415 - 31438542) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000516747 Chr5:31438416..31438649 GGGTCTCGAACCTCTGGTTT Chr5:31438467..31438486 60.49 55
downstream ENSMUSE00000700032 Chr5:31438416..31438541 GGGTCTCGAACCTCTGGTTT Chr5:31438467..31438486 60.49 55
downstream ENSMUSE00000186410 Chr5:31439126..31439148 No primer for this exon
downstream ENSMUSE00000511323 Chr5:31439261..31439385 GCTCCACGCTCACAGAGAAT Chr5:31439349..31439368 60.56 55
downstream ENSMUSE00000270981 Chr5:31439494..31439586 AGCCATGTCGTCATCCTCTT Chr5:31439531..31439550 59.69 50
downstream ENSMUSE00000700031 Chr5:31439571..31439586 No primer for this exon
downstream ENSMUSE00000475666 Chr5:31439850..31439998 TGGATCAGAGTCGGGTCAGT Chr5:31439884..31439903 60.68 55
downstream ENSMUSE00000700029 Chr5:31439856..31440003 TGGATCAGAGTCGGGTCAGT Chr5:31439884..31439903 60.68 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCAGAGGTTCGAGACCCTAA Chr5:31438449..31438469 59.28 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CATGCGTAGGCGAGATCATA Chr5:31438380..31438400 59.82 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000062077