Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21324
Trapped Gene
Itgae (ENSMUSG00000005947)
Vector Insertion
Chr 11: 72954265 - 72959042
Public Clones CMHD-GT_488C6-3 (cmhd) (cmhd) IST10896H8 (tigm) IST14232G11 (tigm)
IST15063B2 (tigm)
Private Clones OST334280 (lexicon) OST57658 (lexicon) OST28198 (lexicon)
Severity of mutation (?) Insertion after 94% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000109167 (Chr11:72954169..72954264 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000109167 (Chr11:72954169..72954264 +)
Downstram Exon
ENSMUSE00000109196 (Chr11:72959043..72959153 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000578528 Chr11:72904085..72904156 No primer for this exon
upstream ENSMUSE00000109187 Chr11:72917363..72917486 No primer for this exon
upstream ENSMUSE00000109174 Chr11:72924008..72924105 No primer for this exon
upstream ENSMUSE00000109195 Chr11:72924833..72924900 No primer for this exon
upstream ENSMUSE00000109172 Chr11:72925248..72925365 No primer for this exon
upstream ENSMUSE00000109200 Chr11:72925559..72925690 No primer for this exon
upstream ENSMUSE00000109198 Chr11:72926456..72926571 No primer for this exon
upstream ENSMUSE00000109199 Chr11:72927084..72927235 No primer for this exon
upstream ENSMUSE00000109177 Chr11:72928359..72928512 No primer for this exon
upstream ENSMUSE00000109176 Chr11:72929009..72929159 No primer for this exon
upstream ENSMUSE00000109192 Chr11:72929582..72929649 No primer for this exon
upstream ENSMUSE00000109194 Chr11:72930616..72930754 No primer for this exon
upstream ENSMUSE00000310701 Chr11:72931554..72931699 No primer for this exon
upstream ENSMUSE00000109191 Chr11:72931997..72932137 No primer for this exon
upstream ENSMUSE00000109188 Chr11:72932832..72933056 No primer for this exon
upstream ENSMUSE00000109189 Chr11:72933777..72933907 No primer for this exon
upstream ENSMUSE00000109208 Chr11:72935346..72935476 No primer for this exon
upstream ENSMUSE00000109204 Chr11:72936610..72936770 No primer for this exon
upstream ENSMUSE00000109169 Chr11:72938761..72938889 No primer for this exon
upstream ENSMUSE00000310663 Chr11:72940381..72940454 No primer for this exon
upstream ENSMUSE00000310656 Chr11:72942671..72942803 No primer for this exon
upstream ENSMUSE00000109209 Chr11:72944425..72944523 No primer for this exon
upstream ENSMUSE00000109201 Chr11:72945190..72945269 No primer for this exon
upstream ENSMUSE00000109205 Chr11:72946196..72946270 No primer for this exon
upstream ENSMUSE00000109166 Chr11:72947345..72947408 No primer for this exon
upstream ENSMUSE00000109190 Chr11:72947493..72947600 No primer for this exon
upstream ENSMUSE00000661863 Chr11:72947493..72947663 No primer for this exon
upstream ENSMUSE00000109203 Chr11:72951957..72952013 No primer for this exon
upstream ENSMUSE00000109197 Chr11:72952269..72952364 No primer for this exon
upstream ENSMUSE00000109167 Chr11:72954169..72954264 No primer for this exon

*** Putative Vector Insertion (Chr 11: 72954265 - 72959042) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000109196 Chr11:72959043..72959153 No primer for this exon
downstream ENSMUSE00000393547 Chr11:72960553..72960943 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACTAATCGCCTTGCAGCACA Chr11:72957314..72957334 61.9 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAACCGTGACTGGGAAAACC Chr11:72954312..72954332 61.14 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000005947