Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21347
Trapped Gene
Dnahc8 (ENSMUSG00000033826)
Vector Insertion
Chr 17: 30761586 - 30772280
Public Clones IST12526H5 (tigm) IST12526H5 (tigm)
Private Clones OST333789 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000657783 (Chr17:30761354..30761585 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGCGGATGTAGAAGCTACC Chr17:30761453..30761472 60.24 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000657783 (Chr17:30761354..30761585 +)
Downstram Exon
ENSMUSE00000346776 (Chr17:30772281..30772778 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGCGGATGTAGAAGCTACC Chr17:30761453..30761472 60.24 55 CGGCAGTGTTACCTCCTCAT Chr17:30772616..30772635 60.13 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000657783 Chr17:30761354..30761585 TGGCGGATGTAGAAGCTACC Chr17:30761453..30761472 60.24 55

*** Putative Vector Insertion (Chr 17: 30761586 - 30772280) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000346776 Chr17:30772281..30772778 CGGCAGTGTTACCTCCTCAT Chr17:30772616..30772635 60.13 55
downstream ENSMUSE00000657782 Chr17:30772887..30773021 GACGGGCAATCCAAAATTAG Chr17:30773023..30773042 59.41 45
downstream ENSMUSE00000657781 Chr17:30780201..30780285 CAGCGTCTTACAGCCACCTT Chr17:30780251..30780270 60.45 55
downstream ENSMUSE00000657780 Chr17:30781502..30781653 TCATTACGACAACGGACGAA Chr17:30781625..30781644 60.11 45
downstream ENSMUSE00000657779 Chr17:30785361..30785550 TGGCTGGGAGAAATATGCTT Chr17:30785448..30785467 59.67 45
downstream ENSMUSE00000657778 Chr17:30786569..30786732 CCCTCGATGCTTATGGTAGC Chr17:30786593..30786612 59.69 55
downstream ENSMUSE00000657777 Chr17:30790178..30790354 GGCTGACATACGCTTCCAAT Chr17:30790267..30790286 60.1 50
downstream ENSMUSE00000657776 Chr17:30793522..30793635 CATTAGCGGAGTCGGTGATT Chr17:30793567..30793586 60.1 50
downstream ENSMUSE00000657775 Chr17:30793831..30793938 AGGTTCTGTATCCCGTGTGC Chr17:30793862..30793881 60 55
downstream ENSMUSE00000657774 Chr17:30794914..30795015 TGCAGGCTGTTACCATCTGA Chr17:30794944..30794963 60.41 50
downstream ENSMUSE00000657773 Chr17:30798931..30799077 GGATGCCTGGTATTCCTTGA Chr17:30798969..30798988 59.89 50
downstream ENSMUSE00000657772 Chr17:30800243..30800440 CGTGGATCCAGGATGTCATA Chr17:30800385..30800404 59.32 50
downstream ENSMUSE00000657771 Chr17:30805219..30805295 TCATAAACGCCTGGATTTGA Chr17:30805243..30805262 59.11 40
downstream ENSMUSE00000657770 Chr17:30807557..30807656 TGATTGATTTCCAGGTGAAGG Chr17:30807603..30807623 59.92 42.86
downstream ENSMUSE00000657769 Chr17:30809185..30809304 GTTCATTTATCCGGCGGAAC Chr17:30809290..30809309 61.55 50
downstream ENSMUSE00000657768 Chr17:30810725..30810860 TGTGTGGTAAGCCACCTCAA Chr17:30810829..30810848 60.15 50
downstream ENSMUSE00000548456 Chr17:30814032..30814219 CTGCCTTCAGTTTGCTCTCC Chr17:30814205..30814224 60.13 55
downstream ENSMUSE00000548523 Chr17:30820576..30820656 TCCTGGCACAGGTCATCATA Chr17:30820613..30820632 60.07 50
downstream ENSMUSE00000657767 Chr17:30821076..30821192 TCCAAAACGGACTCAACCTC Chr17:30821170..30821189 60.09 50
downstream ENSMUSE00000548519 Chr17:30823328..30823447 GCCGCTATCTGACAAGGAGA Chr17:30823414..30823433 60.5 55
downstream ENSMUSE00000548518 Chr17:30827126..30827261 ATCAGCTCTTTCACGGCTTC Chr17:30827202..30827221 59.58 50
downstream ENSMUSE00000548517 Chr17:30830894..30831006 TCGGTCTCTTCTGCCTCACT Chr17:30830942..30830961 60.13 55
downstream ENSMUSE00000657839 Chr17:30832055..30832161 TGATGCGAGAAGAAAGCGTA Chr17:30832092..30832111 59.71 45
downstream ENSMUSE00000548514 Chr17:30837335..30837407 TTGCAAGGTGCACTTCAGTT Chr17:30837399..30837418 59.49 45
downstream ENSMUSE00000548513 Chr17:30838790..30838976 TCCAGGGTCAACTGGATCAT Chr17:30838857..30838876 60.33 50
downstream ENSMUSE00000548511 Chr17:30841600..30841796 GGAGCACCAGCTTGGAGATA Chr17:30841692..30841711 60.36 55
downstream ENSMUSE00000548509 Chr17:30843330..30843456 TCTCAGTCAGGGAAGGGTTG Chr17:30843366..30843385 60.23 55
downstream ENSMUSE00000357731 Chr17:30845236..30845471 GCCTCGATCGATAAGGCTAA Chr17:30845269..30845288 59.42 50
downstream ENSMUSE00000407292 Chr17:30847447..30847551 TTCAAAATGCCGTAGGCTTC Chr17:30847469..30847488 60.21 45
downstream ENSMUSE00000358966 Chr17:30849218..30849331 GACTCGAGCAGGTTGCTTTT Chr17:30849282..30849301 59.62 50
downstream ENSMUSE00000409304 Chr17:30849979..30850041 TTTGGTACCATGGGTCCTTC Chr17:30850001..30850020 59.65 50
downstream ENSMUSE00000365130 Chr17:30852425..30852525 TCCCCGGATGAATATGTGAC Chr17:30852477..30852496 60.55 50
downstream ENSMUSE00000394690 Chr17:30854709..30854846 TGCAGCTCTGCATTGATCTT Chr17:30854834..30854853 59.7 45
downstream ENSMUSE00000369492 Chr17:30855772..30856012 CAGCGGACACGACTCACTAA Chr17:30855865..30855884 60.05 55
downstream ENSMUSE00000332300 Chr17:30857944..30858143 CAAGGAGCCTAGGACCATCA Chr17:30858135..30858154 60.21 55
downstream ENSMUSE00000380998 Chr17:30859844..30859997 ATCCGAGGAAGTGGACAATTT Chr17:30859909..30859929 59.82 42.86
downstream ENSMUSE00000338809 Chr17:30862027..30862190 GATCACGTTGGGGTTCTCAT Chr17:30862107..30862126 59.79 50
downstream ENSMUSE00000491845 Chr17:30863731..30863833 AGAACCGGATCGGAGACAAA Chr17:30863793..30863812 61.92 50
downstream ENSMUSE00000338312 Chr17:30865108..30865212 CCGTCATCCGATCGTAGTCT Chr17:30865183..30865202 60.1 55
downstream ENSMUSE00000393198 Chr17:30866026..30866187 CTTTGGCCATAACGGGAGTA Chr17:30866053..30866072 59.95 50
downstream ENSMUSE00000343731 Chr17:30867959..30868183 TTTGCATGATTTTCCTGTCG Chr17:30868049..30868068 59.66 40
downstream ENSMUSE00000393916 Chr17:30872974..30873146 CCCAGGAACTCGTTTTGGTA Chr17:30873110..30873129 59.96 50
downstream ENSMUSE00000357757 Chr17:30874196..30874374 TTGTGGTTTCGGTTTTACCC Chr17:30874287..30874306 59.7 45
downstream ENSMUSE00000397487 Chr17:30876513..30876700 CCACAGATAAAACGGGCAAT Chr17:30876587..30876606 59.82 45
downstream ENSMUSE00000353338 Chr17:30878072..30878158 No primer for this exon
downstream ENSMUSE00000395441 Chr17:30878253..30878360 AGCTGCTCTTCGCAGAGTTT Chr17:30878353..30878372 59.53 50
downstream ENSMUSE00000351205 Chr17:30879601..30879735 GCCGAGCTCTTTTCTGAGAC Chr17:30879676..30879695 59.31 55
downstream ENSMUSE00000390212 Chr17:30881459..30881620 CGCGTAAGTACTGCTGTCCA Chr17:30881542..30881561 60.07 55
downstream ENSMUSE00000357200 Chr17:30883703..30883949 AGTCGTTGGTGGCTGTATCC Chr17:30883898..30883917 60 55
downstream ENSMUSE00000403148 Chr17:30884092..30884333 GGGTGAGCGTCTTGTTATCG Chr17:30884187..30884206 60.66 55
downstream ENSMUSE00000358247 Chr17:30884792..30884932 CATCTTGGGGTTGAGGCTTA Chr17:30884905..30884924 60.07 50
downstream ENSMUSE00000406257 Chr17:30885453..30885690 AACAGCTTGTGGAGGTGGTC Chr17:30885535..30885554 60.16 55
downstream ENSMUSE00000372898 Chr17:30888392..30888534 CTGTTTCGCGATCGTGTCTA Chr17:30888531..30888550 60.01 50
downstream ENSMUSE00000406252 Chr17:30888992..30889126 TCTTCAGGTACGCCTTCACC Chr17:30889058..30889077 60.26 55
downstream ENSMUSE00000371367 Chr17:30889767..30889889 CCGTAGGTACTCCCCATCCT Chr17:30889816..30889835 60.2 60
downstream ENSMUSE00000410750 Chr17:30891919..30892132 CATCATCTGACGCACGATCT Chr17:30891951..30891970 59.82 50
downstream ENSMUSE00000375617 Chr17:30893648..30893757 ACCAAATTCCCAACCATGTC Chr17:30893726..30893745 59.51 45
downstream ENSMUSE00000488030 Chr17:30895190..30895353 GGATCGAGCTGCACTCTTCT Chr17:30895304..30895323 59.71 55
downstream ENSMUSE00000380572 Chr17:30896515..30896707 AGTGTCTTCGGGTTCGTCAC Chr17:30896680..30896699 60.16 55
downstream ENSMUSE00000471295 Chr17:30897951..30898073 CTCGTTGAATTGCCTCTGGT Chr17:30898013..30898032 60.26 50
downstream ENSMUSE00000473523 Chr17:30899586..30899716 CCACAGGAGGTTCGAATGAT Chr17:30899617..30899636 59.93 50
downstream ENSMUSE00000373905 Chr17:30902541..30902694 TATTCCAGGAACGCCTCATC Chr17:30902669..30902688 60.04 50
downstream ENSMUSE00000340172 Chr17:30904744..30904908 GGGTGATTTCATCCATCTCG Chr17:30904789..30904808 60.28 50
downstream ENSMUSE00000363412 Chr17:30906588..30906814 AGTATGAGGCCACAGCGATT Chr17:30906705..30906724 59.72 50
downstream ENSMUSE00000335299 Chr17:30908742..30908860 ATATTCATCCGTTCCGCTTG Chr17:30908861..30908880 59.92 45
downstream ENSMUSE00000358979 Chr17:30910474..30910577 TCACTGCGAGATCCTGTGAG Chr17:30910539..30910558 60.14 55
downstream ENSMUSE00000351734 Chr17:30911891..30912067 GCTTTCACCTTCTCGCTGTC Chr17:30912012..30912031 60.14 55
downstream ENSMUSE00000374360 Chr17:30915952..30916119 TGTGGCAATGTCATTTGGTT Chr17:30915981..30916000 59.82 40
downstream ENSMUSE00000502266 Chr17:30916668..30916883 CCCTGTTGATGCCGTAAAAT Chr17:30916869..30916888 59.82 45
downstream ENSMUSE00000390970 Chr17:30919329..30919466 GTCAAACTTGGCCTGCACTT Chr17:30919448..30919467 60.3 50
downstream ENSMUSE00000357450 Chr17:30921008..30921135 CTGCATCTTCTTCCTGCACA Chr17:30921052..30921071 60.14 50
downstream ENSMUSE00000402260 Chr17:30921952..30922123 GGAATTTTCCGTGCTTTCAA Chr17:30922077..30922096 60.05 40
downstream ENSMUSE00000342232 Chr17:30924090..30924245 CCTTCGATTTGATCCACGTT Chr17:30924228..30924247 59.93 45
downstream ENSMUSE00000397541 Chr17:30927772..30927927 GGTCCAGCTCCTCTCGAATA Chr17:30927874..30927893 59.39 55
downstream ENSMUSE00000357375 Chr17:30931578..30931760 TGGTTCTCGAGTCCCTTCAT Chr17:30931729..30931748 59.65 50
downstream ENSMUSE00000413996 Chr17:30937429..30937534 GCTCCTTCATCTTCCGCTTA Chr17:30937498..30937517 59.55 50
downstream ENSMUSE00000657789 Chr17:30940008..30940260 GTGGAGCTTTTCGCTCACTT Chr17:30940093..30940112 59.62 50
downstream ENSMUSE00000657788 Chr17:30940938..30941128 TGAGGTAGCGGAGACTTTTCA Chr17:30940963..30940983 60 47.62
downstream ENSMUSE00000369945 Chr17:30944150..30944271 AAGGTTCAGCCACGTCATGT Chr17:30944229..30944248 60.58 50
downstream ENSMUSE00000408854 Chr17:30947205..30947323 GGGCGTCTTTATCAAACCAG Chr17:30947256..30947275 59.57 50
downstream ENSMUSE00000484778 Chr17:30949973..30950175 TGTGCGTGTCACTTTCTTCC Chr17:30950100..30950119 59.88 50
downstream ENSMUSE00000319532 Chr17:30952577..30952650 CTGGATCAGCTTTCGAGCAT Chr17:30952638..30952657 60.5 50
downstream ENSMUSE00000319112 Chr17:30955005..30955157 TCTGCAGTAACACCCAACCA Chr17:30955029..30955048 60.15 50
downstream ENSMUSE00000319495 Chr17:30956064..30956219 CCAGCGAATGTCCTTTTCAG Chr17:30956134..30956153 60.77 50
downstream ENSMUSE00000609528 Chr17:30967718..30967834 No primer for this exon
downstream ENSMUSE00000609527 Chr17:30970501..30970602 CCGAACTGTACTCCACGACA Chr17:30970527..30970546 59.74 55
downstream ENSMUSE00000609526 Chr17:30977498..30977658 GGGATTTTGTAGCCGGTGTA Chr17:30977562..30977581 59.82 50
downstream ENSMUSE00000609525 Chr17:30988573..30988729 TTTCGGTTGAATGTTGGTGA Chr17:30988633..30988652 59.94 40
downstream ENSMUSE00000609524 Chr17:30991746..30991898 ATGATGATCGTCCCTTCGAT Chr17:30991894..30991913 59.32 45
downstream ENSMUSE00000609523 Chr17:30992850..30993039 TAAAGAACCCGGTCATCCAG Chr17:30993033..30993052 59.93 50
downstream ENSMUSE00000609522 Chr17:31008257..31008378 GTGAGCTCGGGTCACTTCTT Chr17:31008300..31008319 59.46 55
downstream ENSMUSE00000609521 Chr17:31011787..31012209 GGAAGCTGCGTGAAGAGAAC Chr17:31011893..31011912 60.14 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr17:30767636..30767656 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CACAGAACGTGACTGGGAAA Chr17:30767630..30767650 59.72 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000033826