Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21356
Trapped Gene
Ralgps2 (ENSMUSG00000026594)
Vector Insertion
Chr 1: 158832022 - 158837769
Public Clones not available
Private Clones OST333535 (lexicon)
Severity of mutation (?) Insertion after 3% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000380719 (Chr1:158837770..158837909 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTATCGCAGCCACTGTTTCC Chr1:158837773..158837792 60.8 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000380719 (Chr1:158837770..158837909 -)
Downstram Exon
ENSMUSE00000274849 (Chr1:158831917..158832021 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTATCGCAGCCACTGTTTCC Chr1:158837773..158837792 60.8 55 TCAGAGCCCTTCTCGCTTAG Chr1:158831959..158831978 59.85 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000594883 Chr1:158869620..158869664 No primer for this exon
upstream ENSMUSE00000380719 Chr1:158837770..158837909 CTATCGCAGCCACTGTTTCC Chr1:158837773..158837792 60.8 55

*** Putative Vector Insertion (Chr 1: 158832022 - 158837769) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000274849 Chr1:158831917..158832021 TCAGAGCCCTTCTCGCTTAG Chr1:158831959..158831978 59.85 55
downstream ENSMUSE00000274840 Chr1:158830717..158830767 No primer for this exon
downstream ENSMUSE00000274832 Chr1:158818078..158818161 CAACTGCATTTGGTGCAGAA Chr1:158818079..158818098 60.84 45
downstream ENSMUSE00000274824 Chr1:158817222..158817311 TTTTCAGTGTTTGAGCATGGA Chr1:158817241..158817261 59.31 38.1
downstream ENSMUSE00000274813 Chr1:158814664..158814756 GCCATAAGTGCGTGAAGGTT Chr1:158814697..158814716 60.14 50
downstream ENSMUSE00000274806 Chr1:158799572..158799698 AGGGAATGCAAGGAGTCATCT Chr1:158799556..158799576 60.09 47.62
downstream ENSMUSE00000537110 Chr1:158763026..158763163 ACGCGGAGTCAATGTAGGTC Chr1:158763103..158763122 60.14 55
downstream ENSMUSE00000160836 Chr1:158762796..158762886 TTTTTGGACATGAGGCAATATG Chr1:158762836..158762857 59.83 36.36
downstream ENSMUSE00000160835 Chr1:158760516..158760583 GCGTGGAGTACTTGCTCCTG Chr1:158760522..158760541 61 60
downstream ENSMUSE00000160840 Chr1:158759103..158759259 CTGTGTCCGTGTGGAATGAG Chr1:158759105..158759124 60.15 55
downstream ENSMUSE00000160832 Chr1:158758271..158758422 GGAACGTTGCGCTCTTAAAC Chr1:158758354..158758373 59.89 50
downstream ENSMUSE00000160837 Chr1:158754122..158754176 No primer for this exon
downstream ENSMUSE00000160834 Chr1:158751518..158751595 GGGCCGAGAGAATGGTATAA Chr1:158751547..158751566 59 50
downstream ENSMUSE00000160831 Chr1:158749944..158750049 CCGGAGCACACCTTGAATAG Chr1:158749958..158749977 60.65 55
downstream ENSMUSE00000160839 Chr1:158747872..158747964 CAGAGATTTGGCGGCATAGT Chr1:158747871..158747890 60.24 50
downstream ENSMUSE00000274758 Chr1:158743569..158743674 TTTCTCGGAGTCAGTCAGCA Chr1:158743548..158743567 59.7 50
downstream ENSMUSE00000385090 Chr1:158741576..158741667 AGCATTGCATTCATCCTGCT Chr1:158741600..158741619 60.78 45
downstream ENSMUSE00000537039 Chr1:158738253..158739324 AAGCGAAGTTCATGGCAGTT Chr1:158739061..158739080 59.88 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGAGATGTAAGCACCGTGTTG Chr1:158837746..158837767 59.77 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGTCGTGACTGGGAAAACC Chr1:158837702..158837722 59.83 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026594