Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21359
Trapped Gene
Stra6 (ENSMUSG00000032327)
Vector Insertion
Chr 9: 57983010 - 57986786
Public Clones IST14802D3 (tigm)
Private Clones OST333389 (lexicon)
Severity of mutation (?) Insertion after 6% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000218734 (Chr9:57982881..57983009 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAAGAAGAGCTGGAGCATGG Chr9:57982881..57982900 60.1 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000218734 (Chr9:57982881..57983009 +)
Downstram Exon
ENSMUSE00000218753 (Chr9:57986787..57986853 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAAGAAGAGCTGGAGCATGG Chr9:57982881..57982900 60.1 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000534056 Chr9:57976895..57976957 CAATTCATCAGGCGATACCC Chr9:57976907..57976926 60.3 50
upstream ENSMUSE00000218739 Chr9:57977156..57977488 AACTACTGCGGCCTCACAAC Chr9:57977291..57977310 60.32 55
upstream ENSMUSE00000218734 Chr9:57982881..57983009 GAAGAAGAGCTGGAGCATGG Chr9:57982881..57982900 60.1 55

*** Putative Vector Insertion (Chr 9: 57983010 - 57986786) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000218753 Chr9:57986787..57986853 No primer for this exon
downstream ENSMUSE00000218722 Chr9:57987163..57987248 No primer for this exon
downstream ENSMUSE00000218729 Chr9:57988221..57988360 CAACAGGCATAGGTTGCTGA Chr9:57988308..57988327 59.86 50
downstream ENSMUSE00000464751 Chr9:57988666..57988689 No primer for this exon
downstream ENSMUSE00000218748 Chr9:57988863..57989029 AGCAGAGCCAGTAGCTTCCA Chr9:57988890..57988909 60.3 55
downstream ENSMUSE00000218744 Chr9:57990722..57990844 TGACGGAGACTCTGCACAAG Chr9:57990825..57990844 60.18 55
downstream ENSMUSE00000218751 Chr9:57993268..57993335 TCTCGGAGTAGCTGGTCTGC Chr9:57993295..57993314 60.7 60
downstream ENSMUSE00000218731 Chr9:57993520..57993599 GAGACAGGAGGCTACGCTTG Chr9:57993557..57993576 60.16 60
downstream ENSMUSE00000218741 Chr9:57993805..57993866 GGTAAGTGGCTGTTCCTGTCA Chr9:57993866..57993886 60.16 52.38
downstream ENSMUSE00000218718 Chr9:57995269..57995431 TTCTGCACAGTAGGCACCAC Chr9:57995315..57995334 59.9 55
downstream ENSMUSE00000218723 Chr9:57996987..57997062 TCAGGAGCAGGAAGGTTGAT Chr9:57997043..57997062 59.8 50
downstream ENSMUSE00000218746 Chr9:57997885..57998018 TTGGCGAGAGGGATGAATAC Chr9:57997966..57997985 60.04 50
downstream ENSMUSE00000218721 Chr9:57998968..57999085 CCATGCAGTAAAGGCACAAA Chr9:57999049..57999068 59.73 45
downstream ENSMUSE00000218720 Chr9:57999170..57999271 TCCAGTTGGCTGCTATGTTCT Chr9:57999230..57999250 59.89 47.62
downstream ENSMUSE00000218750 Chr9:57999686..57999849 AGCATGTTGATGGGGAAGAG Chr9:57999736..57999755 60.07 50
downstream ENSMUSE00000218736 Chr9:58000252..58000407 TGACTCCTGGATGTGACTGG Chr9:58000314..58000333 59.66 55
downstream ENSMUSE00000498406 Chr9:58000960..58001760 GCAGGGTGATGTGGTTTTCT Chr9:58001158..58001177 59.97 50
downstream ENSMUSE00000698271 Chr9:58000960..58001762 GCAGGGTGATGTGGTTTTCT Chr9:58001158..58001177 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TATAATCGCCTTGCAGCACA Chr9:57983059..57983079 60.38 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TAGGAGCTGAGGAGGTGCAG Chr9:57982983..57983003 60.69 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032327