Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21389
Trapped Gene
Extl3 (ENSMUSG00000021978)
Vector Insertion
Chr 14: 65677967 - 65685519
Public Clones not available
Private Clones OST332445 (lexicon)
Severity of mutation (?) Insertion after 83% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000271275 (Chr14:65685520..65685647 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCCCTGGAATGAGATTGAGA Chr14:65685587..65685606 60.16 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000271275 (Chr14:65685520..65685647 -)
Downstram Exon
ENSMUSE00000271265 (Chr14:65677822..65677966 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCCCTGGAATGAGATTGAGA Chr14:65685587..65685606 60.16 50 TCACGTGCTTCTCTCCACAC Chr14:65677924..65677943 60.03 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000519957 Chr14:65699218..65699312 GAGAACAAGCTCTGGTGTCCA Chr14:65699287..65699307 60.44 52.38
upstream ENSMUSE00000271285 Chr14:65694421..65697026 AGCACGTCCTCGATCTCTGT Chr14:65696320..65696339 60.02 55
upstream ENSMUSE00000686938 Chr14:65694421..65696697 AGCACGTCCTCGATCTCTGT Chr14:65696320..65696339 60.02 55
upstream ENSMUSE00000271275 Chr14:65685520..65685647 GCCCTGGAATGAGATTGAGA Chr14:65685587..65685606 60.16 50

*** Putative Vector Insertion (Chr 14: 65677967 - 65685519) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000271265 Chr14:65677822..65677966 TCACGTGCTTCTCTCCACAC Chr14:65677924..65677943 60.03 55
downstream ENSMUSE00000122628 Chr14:65675668..65675796 TTCATGGCGATATCCTCACA Chr14:65675686..65675705 60.03 45
downstream ENSMUSE00000271243 Chr14:65670901..65673659 AATCACAAGCAGGGTCCAAC Chr14:65671304..65671323 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATCGACGATGATGCTCACCT Chr14:65682548..65682568 60.65 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATCGACGATGATGCTCACCT Chr14:65682548..65682568 60.65 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021978