Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21407
Trapped Gene
Bdp1 (ENSMUSG00000049658)
Vector Insertion
Chr 13: 100831462 - 100834313
Public Clones not available
Private Clones OST331988 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000293381 (Chr13:100834314..100834444 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCAGCCCCAGGTTCTTAGTG Chr13:100834324..100834343 60.25 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000293381 (Chr13:100834314..100834444 -)
Downstram Exon
ENSMUSE00000569404 (Chr13:100830249..100831461 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCAGCCCCAGGTTCTTAGTG Chr13:100834324..100834343 60.25 55 TTCGGATCTCCATTCGTTTC Chr13:100830438..100830457 60.01 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000293416 Chr13:100845460..100845576 TTGCAGGTTTAGCACCCAGT Chr13:100845501..100845520 60.69 50
upstream ENSMUSE00000293410 Chr13:100844342..100844500 CATGCCACTAGCAAGGGAGT Chr13:100844466..100844485 60.28 55
upstream ENSMUSE00000293404 Chr13:100840032..100840191 GCAGTTGGGAAGAAATCAGC Chr13:100840096..100840115 59.82 50
upstream ENSMUSE00000293396 Chr13:100837420..100837511 GGTGCCAAAACTGTGTCTGA Chr13:100837420..100837439 59.73 50
upstream ENSMUSE00000293390 Chr13:100835832..100836021 TGAGGAGTCGAATGCAAAGA Chr13:100835937..100835956 59.52 45
upstream ENSMUSE00000293381 Chr13:100834314..100834444 TCAGCCCCAGGTTCTTAGTG Chr13:100834324..100834343 60.25 55

*** Putative Vector Insertion (Chr 13: 100831462 - 100834313) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000569404 Chr13:100830249..100831461 TTCGGATCTCCATTCGTTTC Chr13:100830438..100830457 60.01 45
downstream ENSMUSE00000611201 Chr13:100829444..100829625 GCATCCCTTGGTCTGTTTCA Chr13:100829465..100829484 61.05 50
downstream ENSMUSE00000611200 Chr13:100828681..100828900 AGCAGCTTGGTCACTGTCCT Chr13:100828674..100828693 60.06 55
downstream ENSMUSE00000611199 Chr13:100826114..100826295 ACTTGAATTTGGCGGTGAAG Chr13:100826154..100826173 60.11 45
downstream ENSMUSE00000611198 Chr13:100825051..100825258 CTCTGAAGTCGACCCCTCAC Chr13:100825153..100825172 59.83 60
downstream ENSMUSE00000611197 Chr13:100822928..100823073 GGAGGACATGTCAACTGCAA Chr13:100823004..100823023 59.68 50
downstream ENSMUSE00000611196 Chr13:100821303..100821510 GTGCTGTGCTCTCGTCTGTC Chr13:100821346..100821365 59.77 60
downstream ENSMUSE00000611195 Chr13:100820900..100821084 GCTGAGCATCGTTTCTGTCA Chr13:100820975..100820994 60.14 50
downstream ENSMUSE00000611194 Chr13:100819591..100819984 TTCTGGGGCAAGATGATAGG Chr13:100819656..100819675 60.03 50
downstream ENSMUSE00000611193 Chr13:100816681..100816794 ATGGCGGATACACAGCTTTC Chr13:100816664..100816683 60.1 50
downstream ENSMUSE00000611192 Chr13:100814227..100814263 TTGGGTCTGTTCACCTACGTC Chr13:100814215..100814235 60.02 52.38
downstream ENSMUSE00000611191 Chr13:100813714..100813806 No primer for this exon
downstream ENSMUSE00000680074 Chr13:100812380..100812386 No primer for this exon
downstream ENSMUSE00000293575 Chr13:100812015..100812240 GGTGAACAAACCTCCGGATA Chr13:100812107..100812126 59.79 50
downstream ENSMUSE00000293567 Chr13:100811377..100811537 CTGGCAACTTCCTGATGACC Chr13:100811396..100811415 60.66 55
downstream ENSMUSE00000293557 Chr13:100808077..100808227 ACACTGCGACTGCTCCTCTT Chr13:100808108..100808127 60.21 55
downstream ENSMUSE00000680073 Chr13:100808077..100808233 ACACTGCGACTGCTCCTCTT Chr13:100808108..100808127 60.21 55
downstream ENSMUSE00000293546 Chr13:100807715..100807892 AGCAACTGCAGTACCCGACT Chr13:100807813..100807832 59.94 55
downstream ENSMUSE00000293536 Chr13:100805734..100805794 TTGAGGACCGGTGTTTTCTT Chr13:100805722..100805741 59.57 45
downstream ENSMUSE00000293527 Chr13:100805039..100805225 GCAGAGAGCTCGGCATTAAC Chr13:100805072..100805091 60.12 55
downstream ENSMUSE00000293516 Chr13:100800740..100800944 GTGAGGACTTTTTGGCAGGA Chr13:100800756..100800775 60.23 50
downstream ENSMUSE00000293508 Chr13:100797390..100797426 No primer for this exon
downstream ENSMUSE00000371885 Chr13:100795352..100795610 TTGTCCCATGCAAGACTCTG Chr13:100795569..100795588 59.83 50
downstream ENSMUSE00000293491 Chr13:100793555..100793810 AAATTTCGCCGTGATACAGG Chr13:100793660..100793679 59.96 45
downstream ENSMUSE00000359807 Chr13:100787952..100790365 TCACCTCTTCCTCAGGTGCT Chr13:100790271..100790290 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGCCCCAGGTTCTTAGTGA Chr13:100834321..100834341 60.25 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGCCCCAGGTTCTTAGTGA Chr13:100834321..100834341 60.25 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000049658