Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21412
Trapped Gene
AC142244.11 (ENSMUSG00000026558)
Vector Insertion
Chr 1: 169160122 - 169164822
Public Clones not available
Private Clones OST331866 (lexicon) OST290014 (lexicon)
Severity of mutation (?) Insertion after 64% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000160516 (Chr1:169164823..169164965 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGCTCTTCGAAGGGATCCTA Chr1:169164908..169164927 59.91 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000160516 (Chr1:169164823..169164965 -)
Downstram Exon
ENSMUSE00000160515 (Chr1:169160024..169160121 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGCTCTTCGAAGGGATCCTA Chr1:169164908..169164927 59.91 50 CTCCCTCTTTCGCTGATGTC Chr1:169160072..169160091 59.95 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000224798 Chr1:169214907..169215192 No primer for this exon
upstream ENSMUSE00000160510 Chr1:169167620..169167779 AAGCAGGTGGTGATCCTGAG Chr1:169167700..169167719 60.26 55
upstream ENSMUSE00000160512 Chr1:169166734..169166830 CAGATCCCCGTGTACGACTT Chr1:169166749..169166768 59.99 55
upstream ENSMUSE00000160516 Chr1:169164823..169164965 TGCTCTTCGAAGGGATCCTA Chr1:169164908..169164927 59.91 50

*** Putative Vector Insertion (Chr 1: 169160122 - 169164822) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000160515 Chr1:169160024..169160121 CTCCCTCTTTCGCTGATGTC Chr1:169160072..169160091 59.95 55
downstream ENSMUSE00000160514 Chr1:169157863..169157911 GATTGTCGGCACCTCTAGGA Chr1:169157844..169157863 60.22 55
downstream ENSMUSE00000359419 Chr1:169156219..169156652 GGGGTGTAGCCGTTGAGATA Chr1:169156537..169156556 59.96 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTCACAGGAGGGTAGGCTTG Chr1:169161793..169161813 59.72 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTCACAGGAGGGTAGGCTTG Chr1:169161793..169161813 59.72 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026558