Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2143
Trapped Gene
6720457D02Rik (ENSMUSG00000074865)
Vector Insertion
Chr 13: 62621905 - 62659846
Public Clones AB0076 (sanger) XR1000 (sanger) AN0560 (sanger) IST11324D11 (tigm)
IST15063F5 (tigm) IST10092A2 (tigm) IST10890H9 (tigm) IST10611G8 (tigm)
IST15081D4 (tigm) IST14374H11 (tigm) IST14732H8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000681632 (Chr13:62659847..62659989 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCTCTGTTCCTCTCCGTTGC Chr13:62659936..62659955 60.53 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000681632 (Chr13:62659847..62659989 -)
Downstram Exon
ENSMUSE00000681631 (Chr13:62621778..62621904 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCTCTGTTCCTCTCCGTTGC Chr13:62659936..62659955 60.53 55 TGAGAAGGATCCAGCAGAGC Chr13:62621812..62621831 60.65 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000681632 Chr13:62659847..62659989 TCTCTGTTCCTCTCCGTTGC Chr13:62659936..62659955 60.53 55

*** Putative Vector Insertion (Chr 13: 62621905 - 62659846) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000681631 Chr13:62621778..62621904 TGAGAAGGATCCAGCAGAGC Chr13:62621812..62621831 60.65 55
downstream ENSMUSE00000605944 Chr13:62621532..62621592 TTTTGGGCTTCCCAATTAAA Chr13:62621549..62621568 59.41 35
downstream ENSMUSE00000641537 Chr13:62619425..62620090 CATGTGAAGGGTTGCTCTCC Chr13:62619772..62619791 60.66 55
downstream ENSMUSE00000605943 Chr13:62618860..62619088 GAGAAAAGGCTTTATCGCATTG Chr13:62618990..62619011 60.22 40.91

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGACTGTCCTGTGCTTCATGC Chr13:62638823..62638844 62.45 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGACTGTCCTGTGCTTCATGC Chr13:62638823..62638844 62.45 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 ATAATCGCCTTGCAGCACAT Chr13:62638920..62638940 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CTCTGTTCCTCTCCCGTGAC Chr13:62623933..62623953 59.83 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000074865