Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21431
Trapped Gene
Acvr2b (ENSMUSG00000061393)
Vector Insertion
Chr 9: 119341962 - 119342384
Public Clones not available
Private Clones OST330291 (lexicon)
Severity of mutation (?) Insertion after 88% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000582980 (Chr9:119341831..119341961 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAAGATGAGGCCCACGATTA Chr9:119341919..119341938 60.04 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000582980 (Chr9:119341831..119341961 +)
Downstram Exon
ENSMUSE00000503618 (Chr9:119342385..119342619 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAAGATGAGGCCCACGATTA Chr9:119341919..119341938 60.04 50 GCTGGACTCTTTAGGGAGCA Chr9:119342576..119342595 59.57 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000497501 Chr9:119311562..119311715 CTTCTCTGGGGATCGCTGTG Chr9:119311691..119311710 63.24 60
upstream ENSMUSE00000496474 Chr9:119336573..119336780 ACCATCGAGCTGGTGAAGAA Chr9:119336725..119336744 60.8 50
upstream ENSMUSE00000582985 Chr9:119337085..119337194 AAGGCAACTTCTGCAACGAG Chr9:119337138..119337157 60.57 50
upstream ENSMUSE00000450044 Chr9:119337319..119337686 CTGTGCGGACTCCTTTAAGC Chr9:119337509..119337528 60.01 55
upstream ENSMUSE00000688697 Chr9:119337319..119337470 GGCCTTCTGGATGTATCGTC Chr9:119337413..119337432 59.51 55
upstream ENSMUSE00000688696 Chr9:119337543..119337686 GAACGACTTTGTGGCTGTGA Chr9:119337650..119337669 59.88 50
upstream ENSMUSE00000582984 Chr9:119338983..119339126 GGCATGAAGCACGAAAACTT Chr9:119339028..119339047 60.26 45
upstream ENSMUSE00000582983 Chr9:119339338..119339486 CATCATCACGTGGAACGAAC Chr9:119339367..119339386 59.97 50
upstream ENSMUSE00000582982 Chr9:119340342..119340456 No primer for this exon
upstream ENSMUSE00000582981 Chr9:119341607..119341745 GAAGGAGCCATCAACTTCCA Chr9:119341643..119341662 60.19 50
upstream ENSMUSE00000582980 Chr9:119341831..119341961 GAAGATGAGGCCCACGATTA Chr9:119341919..119341938 60.04 50

*** Putative Vector Insertion (Chr 9: 119341962 - 119342384) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000503618 Chr9:119342385..119342619 GCTGGACTCTTTAGGGAGCA Chr9:119342576..119342595 59.57 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGTGAAGGGGAAGCTGCTA Chr9:119341995..119342015 60.4 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGAAGATGAGGCCCACGATT Chr9:119341919..119341939 60.99 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000061393