Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21434
Trapped Gene
Fxr1 (ENSMUSG00000027680)
Vector Insertion
Chr 3: 33946671 - 33948074
Public Clones not available
Private Clones OST330158 (lexicon)
Severity of mutation (?) Insertion after 39% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000639569 (Chr3:33946554..33946670 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATTCGGACGAAGTTGATGCT Chr3:33946614..33946633 59.7 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000639569 (Chr3:33946554..33946670 +)
Downstram Exon
ENSMUSE00000639568 (Chr3:33948075..33948245 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATTCGGACGAAGTTGATGCT Chr3:33946614..33946633 59.7 45 AACGTTCCGGTGTCTTCATC Chr3:33948232..33948251 59.97 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000489359 Chr3:33919030..33919085 No primer for this exon
upstream ENSMUSE00000450747 Chr3:33938449..33938501 GTCCACGAAGACTCCCTCAC Chr3:33938464..33938483 59.69 60
upstream ENSMUSE00000639573 Chr3:33939985..33940078 AACGCCAGGTTCCGTTTAAT Chr3:33939996..33940015 60.72 45
upstream ENSMUSE00000639572 Chr3:33944954..33945025 GCTGGCTAAAGTTCGGATGA Chr3:33944995..33945014 60.35 50
upstream ENSMUSE00000639571 Chr3:33945359..33945507 TTCGGCCTGTCAATCAAAAT Chr3:33945423..33945442 60.45 40
upstream ENSMUSE00000639570 Chr3:33945888..33945981 AAAGCAGTAGGAGCATGCAGA Chr3:33945922..33945942 60.17 47.62
upstream ENSMUSE00000639569 Chr3:33946554..33946670 ATTCGGACGAAGTTGATGCT Chr3:33946614..33946633 59.7 45

*** Putative Vector Insertion (Chr 3: 33946671 - 33948074) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000639568 Chr3:33948075..33948245 AACGTTCCGGTGTCTTCATC Chr3:33948232..33948251 59.97 50
downstream ENSMUSE00000639567 Chr3:33948997..33949075 No primer for this exon
downstream ENSMUSE00000639566 Chr3:33953144..33953253 TTCTTACTCGAACCACACCAGA Chr3:33953216..33953237 59.77 45.46
downstream ENSMUSE00000639564 Chr3:33955252..33955338 GCACATTCCCAATGCTTTCT Chr3:33955306..33955325 60.08 45
downstream ENSMUSE00000172139 Chr3:33956946..33957153 CATCAATCTGCAGACGTTCC Chr3:33956988..33957007 59.24 50
downstream ENSMUSE00000520260 Chr3:33956946..33957003 CATCAATCTGCAGACGTTCC Chr3:33956988..33957007 59.24 50
downstream ENSMUSE00000515423 Chr3:33957091..33957153 ACGACCTCTGCCTCTTCCAC Chr3:33957128..33957147 61.78 60
downstream ENSMUSE00000639563 Chr3:33960750..33960953 TGTCTCGCTGATGTCGAGTC Chr3:33960866..33960885 60.15 55
downstream ENSMUSE00000592734 Chr3:33963041..33963245 ACCGCCTACGACGGTTAGTA Chr3:33963157..33963176 59.65 55
downstream ENSMUSE00000592745 Chr3:33963041..33963241 ACCGCCTACGACGGTTAGTA Chr3:33963157..33963176 59.65 55
downstream ENSMUSE00000172137 Chr3:33963896..33963976 GGCTGTCTATCTTCTGCCTGA Chr3:33963976..33963996 59.59 52.38
downstream ENSMUSE00000675906 Chr3:33965422..33965431 No primer for this exon
downstream ENSMUSE00000172144 Chr3:33967083..33967174 TGGGAGGTTTCTTTGTCTGC Chr3:33967144..33967163 60.23 50
downstream ENSMUSE00000514715 Chr3:33967839..33968259 CCTTTTCTGAAGGACCATGC Chr3:33967881..33967900 59.67 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTAATCGCCTTGCAGCACAT Chr3:33946721..33946741 61.32 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACTACCGTGACTGGGAAAACC Chr3:33946717..33946738 60.27 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027680