Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2144
Trapped Gene
Cobl (ENSMUSG00000020173)
Vector Insertion
Chr 11: 12148824 - 12149652
Public Clones AB0031 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000329214 (Chr11:12149653..12149916 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000329214 (Chr11:12149653..12149916 -)
Downstram Exon
ENSMUSE00000681105 (Chr11:12148809..12148823 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000681104 Chr11:12364685..12364755 No primer for this exon
upstream ENSMUSE00000681112 Chr11:12364685..12364862 No primer for this exon
upstream ENSMUSE00000712382 Chr11:12364685..12364803 No primer for this exon
upstream ENSMUSE00000715574 Chr11:12364685..12364803 No primer for this exon
upstream ENSMUSE00000332930 Chr11:12286566..12286769 No primer for this exon
upstream ENSMUSE00000581044 Chr11:12286566..12286769 No primer for this exon
upstream ENSMUSE00000581043 Chr11:12278152..12278362 No primer for this exon
upstream ENSMUSE00000711386 Chr11:12278152..12278362 No primer for this exon
upstream ENSMUSE00000712800 Chr11:12278152..12278362 No primer for this exon
upstream ENSMUSE00000581035 Chr11:12275813..12276041 No primer for this exon
upstream ENSMUSE00000655456 Chr11:12275813..12276041 No primer for this exon
upstream ENSMUSE00000581031 Chr11:12273332..12273376 No primer for this exon
upstream ENSMUSE00000581034 Chr11:12269597..12269694 No primer for this exon
upstream ENSMUSE00000655454 Chr11:12269597..12269694 No primer for this exon
upstream ENSMUSE00000655452 Chr11:12265108..12265182 No primer for this exon
upstream ENSMUSE00000710141 Chr11:12243747..12243920 No primer for this exon
upstream ENSMUSE00000717520 Chr11:12243747..12243920 No primer for this exon
upstream ENSMUSE00000681102 Chr11:12243005..12243014 No primer for this exon
upstream ENSMUSE00000681101 Chr11:12242618..12242625 No primer for this exon
upstream ENSMUSE00000655448 Chr11:12209617..12209755 No primer for this exon
upstream ENSMUSE00000681099 Chr11:12209617..12209755 No primer for this exon
upstream ENSMUSE00000329082 Chr11:12206961..12207131 No primer for this exon
upstream ENSMUSE00000681098 Chr11:12206961..12207131 No primer for this exon
upstream ENSMUSE00000581033 Chr11:12196527..12196570 No primer for this exon
upstream ENSMUSE00000443865 Chr11:12166859..12167147 No primer for this exon
upstream ENSMUSE00000681097 Chr11:12166859..12167147 No primer for this exon
upstream ENSMUSE00000349789 Chr11:12156148..12156245 No primer for this exon
upstream ENSMUSE00000681096 Chr11:12156148..12156245 No primer for this exon
upstream ENSMUSE00000390287 Chr11:12153092..12154974 No primer for this exon
upstream ENSMUSE00000681094 Chr11:12153090..12154974 No primer for this exon
upstream ENSMUSE00000329219 Chr11:12151026..12151145 No primer for this exon
upstream ENSMUSE00000681093 Chr11:12151026..12151143 No primer for this exon
upstream ENSMUSE00000329214 Chr11:12149653..12149916 No primer for this exon
upstream ENSMUSE00000681092 Chr11:12149653..12149916 No primer for this exon

*** Putative Vector Insertion (Chr 11: 12148824 - 12149652) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000681105 Chr11:12148809..12148823 No primer for this exon
downstream ENSMUSE00000594209 Chr11:12136681..12138062 No primer for this exon
downstream ENSMUSE00000681108 Chr11:12136679..12138062 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCATTCGTGCAGAAAACAGA Chr11:12149627..12149647 59.99 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCATTCGTGCAGAAAACAGA Chr11:12149627..12149647 59.99 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020173