Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21447
Trapped Gene
A230083H22Rik (ENSMUSG00000039126)
Vector Insertion
Chr 19: 17253481 - 17267745
Public Clones not available
Private Clones OST329954 (lexicon) OST314645 (lexicon) OST237902 (lexicon) OST208981 (lexicon)
OST207215 (lexicon)
Severity of mutation (?) Insertion after 29% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000230568 (Chr19:17253280..17253480 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCGATACCCCTGATGAAGC Chr19:17253435..17253454 59.65 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000230568 (Chr19:17253280..17253480 +)
Downstram Exon
ENSMUSE00000230548 (Chr19:17267746..17267919 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCGATACCCCTGATGAAGC Chr19:17253435..17253454 59.65 55 TTCATGTCAATCCGTTGCTC Chr19:17267884..17267903 59.65 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000490413 Chr19:17197459..17199082 CAGCGAACCCCAACATAACT Chr19:17197692..17197711 59.99 50
upstream ENSMUSE00000620829 Chr19:17199428..17200193 AAAACCCTGCACAAGACCAG Chr19:17199791..17199810 60.15 50
upstream ENSMUSE00000642599 Chr19:17211254..17211381 TCACGTGACCAGAAAATGGA Chr19:17211254..17211273 60.09 45
upstream ENSMUSE00000620828 Chr19:17242753..17242832 ATCCACTTCGAGGAGGGAGT Chr19:17242781..17242800 60.07 55
upstream ENSMUSE00000642598 Chr19:17242753..17242832 ATCCACTTCGAGGAGGGAGT Chr19:17242781..17242800 60.07 55
upstream ENSMUSE00000230568 Chr19:17253280..17253480 CTCGATACCCCTGATGAAGC Chr19:17253435..17253454 59.65 55

*** Putative Vector Insertion (Chr 19: 17253481 - 17267745) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000230548 Chr19:17267746..17267919 TTCATGTCAATCCGTTGCTC Chr19:17267884..17267903 59.65 45
downstream ENSMUSE00000693441 Chr19:17270413..17270421 No primer for this exon
downstream ENSMUSE00000230524 Chr19:17273603..17273705 CATTCAGACCGTCCCCATAG Chr19:17273629..17273648 60.33 55
downstream ENSMUSE00000230419 Chr19:17274271..17274402 TTGGGGTTGCACCATTTAAG Chr19:17274347..17274366 60.72 45
downstream ENSMUSE00000230392 Chr19:17276132..17276218 AAAGGCCGAGTCACTGCTAA Chr19:17276215..17276234 60.01 50
downstream ENSMUSE00000400538 Chr19:17282721..17282819 GCTCTCTGGAATGTGGATGC Chr19:17282814..17282833 60.78 55
downstream ENSMUSE00000620827 Chr19:17286168..17286203 No primer for this exon
downstream ENSMUSE00000360440 Chr19:17286782..17286820 ATGCCTCCCTCAGTTCTTCA Chr19:17286810..17286829 59.8 50
downstream ENSMUSE00000346771 Chr19:17290816..17290863 No primer for this exon
downstream ENSMUSE00000409716 Chr19:17295274..17296299 GGTAGGTACGTCCCAGCAAA Chr19:17295366..17295385 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGGTGGGTTGAGATCTTTTA Chr19:17265468..17265489 60.17 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGGTGGGTTGAGATCTTTTA Chr19:17265468..17265489 60.17 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039126