Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2145
Trapped Gene
Tspan5 (ENSMUSG00000028152)
Vector Insertion
Chr 3: 138405625 - 138472837
Public Clones (sanger) AA0239 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000355602 (Chr3:138405159..138405624 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATGTCCGGGAAGCACTACAA Chr3:138405544..138405563 60.52 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000355602 (Chr3:138405159..138405624 +)
Downstram Exon
ENSMUSE00000720974 (Chr3:138472838..138472988 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATGTCCGGGAAGCACTACAA Chr3:138405544..138405563 60.52 50 CTGCTCAGGAATCCCTTCTG Chr3:138472976..138472995 59.94 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000355602 Chr3:138405159..138405624 ATGTCCGGGAAGCACTACAA Chr3:138405544..138405563 60.52 50

*** Putative Vector Insertion (Chr 3: 138405625 - 138472837) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000720974 Chr3:138472838..138472988 CTGCTCAGGAATCCCTTCTG Chr3:138472976..138472995 59.94 55
downstream ENSMUSE00000713992 Chr3:138523457..138523631 AGCAATTTCACCTGCGATCT Chr3:138523563..138523582 59.84 45
downstream ENSMUSE00000238498 Chr3:138531310..138531360 CCACAGTCCGATTCCAAGAA Chr3:138531348..138531367 61.03 50
downstream ENSMUSE00000709126 Chr3:138531310..138531360 CCACAGTCCGATTCCAAGAA Chr3:138531348..138531367 61.03 50
downstream ENSMUSE00000238489 Chr3:138553699..138553845 AAAGCCACACTGGGTCAAAG Chr3:138553762..138553781 60.15 50
downstream ENSMUSE00000176787 Chr3:138557312..138557482 AACACCCCAGCAGTGAGTTC Chr3:138557367..138557386 60.16 55
downstream ENSMUSE00000176780 Chr3:138559753..138559878 GGGTCTTTAGTGCAGCAGGA Chr3:138559877..138559896 60.4 55
downstream ENSMUSE00000176783 Chr3:138561077..138561124 CCTGGCATCATAGCCACACT Chr3:138561118..138561137 61.09 55
downstream ENSMUSE00000176789 Chr3:138561231..138561347 TGAAAATACCAGCCACGATG Chr3:138561330..138561349 59.54 45
downstream ENSMUSE00000398925 Chr3:138565343..138567388 TAAAACTCGCTTGGGCTTGT Chr3:138567314..138567333 59.88 45
downstream ENSMUSE00000713354 Chr3:138565343..138565621 CAAGTTCCGTCTGTGAGCAG Chr3:138565600..138565619 59.62 55
downstream ENSMUSE00000715489 Chr3:138565343..138566638 AGCCCTGACAGCTTCAATGT Chr3:138565402..138565421 59.87 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGAGTGCTGTAATCGCCTTG Chr3:138447667..138447687 60.01 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTCTCGTGACTGGGAAAACC Chr3:138447672..138447692 59.7 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028152