Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2146
Trapped Gene
Sec16a (ENSMUSG00000026924)
Vector Insertion
Chr 2: 26279517 - 26279936
Public Clones AA0160 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000371910 (Chr2:26279937..26280077 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGCCTGGTGCATACTCTCC Chr2:26279962..26279981 60.82 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000371910 (Chr2:26279937..26280077 -)
Downstram Exon
ENSMUSE00000234844 (Chr2:26279403..26279516 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGCCTGGTGCATACTCTCC Chr2:26279962..26279981 60.82 60 GGATCGAAGAGGCGTAACTG Chr2:26279466..26279485 59.84 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000698094 Chr2:26300595..26300736 AGAAGCCAACCACAGCTCAC Chr2:26300598..26300617 60.45 55
upstream ENSMUSE00000698045 Chr2:26295035..26295274 AACCCTCCCAAGGTAGGAGA Chr2:26295057..26295076 59.93 55
upstream ENSMUSE00000698052 Chr2:26294294..26294950 CTCAAAGTCCGCATCCAAAT Chr2:26294630..26294649 60.07 45
upstream ENSMUSE00000604900 Chr2:26293907..26297590 CTTCACCGTACCCGTCAGAT Chr2:26293934..26293953 59.99 55
upstream ENSMUSE00000698044 Chr2:26293907..26294338 CTTCACCGTACCCGTCAGAT Chr2:26293934..26293953 59.99 55
upstream ENSMUSE00000604899 Chr2:26291432..26291568 GAACCACCGCTATTCTGAGC Chr2:26291484..26291503 59.84 55
upstream ENSMUSE00000698042 Chr2:26289313..26291568 AGGTAGTGGCAGGCTCTTGA Chr2:26289828..26289847 60.01 55
upstream ENSMUSE00000604898 Chr2:26288851..26288948 GAGTGGATGGAGCAGTCACA Chr2:26288896..26288915 59.83 55
upstream ENSMUSE00000604897 Chr2:26286625..26286748 GGGACCGGAGGTACTGGTAT Chr2:26286675..26286694 60.07 60
upstream ENSMUSE00000604896 Chr2:26285914..26286112 GAGGTATGACCCTCGCTTCA Chr2:26286069..26286088 60.22 55
upstream ENSMUSE00000604895 Chr2:26285597..26285771 ACAGCTACCCTGCAGACACC Chr2:26285619..26285638 60.33 60
upstream ENSMUSE00000164319 Chr2:26284894..26285036 TCCATCAAGACCGACCTCTC Chr2:26285016..26285035 60.2 55
upstream ENSMUSE00000164339 Chr2:26284582..26284643 CACACACCTGAGCAGGAAGA Chr2:26284612..26284631 60.02 55
upstream ENSMUSE00000164323 Chr2:26284335..26284473 TTGCACAGAACAAAGCAACA Chr2:26284422..26284441 59.04 40
upstream ENSMUSE00000346870 Chr2:26283660..26283905 GAGCTTTTGTTACGGGACCA Chr2:26283862..26283881 60.11 50
upstream ENSMUSE00000698051 Chr2:26283660..26283755 TTCCGTGAGCTCTTGCTGTA Chr2:26283673..26283692 59.74 50
upstream ENSMUSE00000604894 Chr2:26281971..26282068 TCTGGAGTCTGCCATGAAAA Chr2:26282044..26282063 59.37 45
upstream ENSMUSE00000604893 Chr2:26281600..26281681 TGCAGACTGTCTACCAGCTCA Chr2:26281629..26281649 59.78 52.38
upstream ENSMUSE00000604892 Chr2:26281287..26281404 TTGCAATGGTTTTGTCCAAC Chr2:26281345..26281364 59.42 40
upstream ENSMUSE00000164321 Chr2:26280996..26281107 CTGTTGGATGCTGCACACTT Chr2:26281077..26281096 59.9 50
upstream ENSMUSE00000164331 Chr2:26280714..26280819 CAAAGGACGGAGGCTTATGA Chr2:26280763..26280782 60.21 50
upstream ENSMUSE00000371910 Chr2:26279937..26280077 CAGCCTGGTGCATACTCTCC Chr2:26279962..26279981 60.82 60

*** Putative Vector Insertion (Chr 2: 26279517 - 26279936) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000234844 Chr2:26279403..26279516 GGATCGAAGAGGCGTAACTG Chr2:26279466..26279485 59.84 55
downstream ENSMUSE00000234837 Chr2:26278974..26279157 CGATGTAATGCGACACTGCT Chr2:26279076..26279095 59.9 50
downstream ENSMUSE00000459843 Chr2:26277528..26277773 GTCCATAGGCAGGACTCAGC Chr2:26277647..26277666 59.83 60
downstream ENSMUSE00000164312 Chr2:26276894..26276976 CTCGCCAAACTCCTCTTGAC Chr2:26276887..26276906 59.99 55
downstream ENSMUSE00000164314 Chr2:26275141..26275290 AAGATGGTGCACGTGTCAAA Chr2:26275187..26275206 60.16 45
downstream ENSMUSE00000164328 Chr2:26272154..26272231 CCAACGAGAGAACCAGGACT Chr2:26272186..26272205 59.3 55
downstream ENSMUSE00000164318 Chr2:26271891..26271947 No primer for this exon
downstream ENSMUSE00000164315 Chr2:26271637..26271748 No primer for this exon
downstream ENSMUSE00000164313 Chr2:26271154..26271291 AGGAGCAAGAGCTGGTTCAC Chr2:26271196..26271215 59.6 55
downstream ENSMUSE00000164320 Chr2:26270827..26270921 CAGGGTGGACTCTGCCTTAG Chr2:26270814..26270833 59.86 60
downstream ENSMUSE00000164337 Chr2:26269891..26269965 CCATCTGGTTTGGAGGGTAA Chr2:26269885..26269904 59.78 50
downstream ENSMUSE00000164330 Chr2:26269199..26269258 CAGAGAGCTACAACGCGAGA Chr2:26269216..26269235 59.49 55
downstream ENSMUSE00000164335 Chr2:26268356..26268433 AGGGTTGTAAAAGGGCACAG Chr2:26268349..26268368 59.1 50
downstream ENSMUSE00000516870 Chr2:26264953..26266473 CTGGCATGTACTCCCCAGTT Chr2:26265855..26265874 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTGCCTTCCTGTTAGCATC Chr2:26279903..26279923 59.7 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGTGCCTTCCTGTTAGCATC Chr2:26279903..26279923 59.7 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026924