Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21463
Trapped Gene
Ddc (ENSMUSG00000020182)
Vector Insertion
Chr 11: 11729182 - 11735744
Public Clones (sanger) (cmhd) (cmhd) IST12717B12 (tigm) IST11490F4 (tigm) IST11804D6 (tigm)
IST10325B1 (tigm) IST14937C7 (tigm) IST10325B1 (tigm) IST11322F6 (tigm)
IST10755E3 (tigm) IST10063D7 (tigm) IST10385H10 (tigm) IST12488G11 (tigm)
Private Clones OST329553 (lexicon)
Severity of mutation (?) Insertion after 65% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000101616 (Chr11:11735745..11735812 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000101616 (Chr11:11735745..11735812 -)
Downstram Exon
ENSMUSE00000101613 (Chr11:11729105..11729181 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000517817 Chr11:11798011..11798047 No primer for this exon
upstream ENSMUSE00000681142 Chr11:11790341..11790404 No primer for this exon
upstream ENSMUSE00000520659 Chr11:11780445..11780653 No primer for this exon
upstream ENSMUSE00000708796 Chr11:11780445..11780653 No primer for this exon
upstream ENSMUSE00000101526 Chr11:11776248..11776361 No primer for this exon
upstream ENSMUSE00000655479 Chr11:11775515..11775595 No primer for this exon
upstream ENSMUSE00000329914 Chr11:11773137..11773256 No primer for this exon
upstream ENSMUSE00000101542 Chr11:11764897..11765031 No primer for this exon
upstream ENSMUSE00000329897 Chr11:11763654..11763797 No primer for this exon
upstream ENSMUSE00000101608 Chr11:11746639..11746705 No primer for this exon
upstream ENSMUSE00000101620 Chr11:11739401..11739495 No primer for this exon
upstream ENSMUSE00000101616 Chr11:11735745..11735812 No primer for this exon

*** Putative Vector Insertion (Chr 11: 11729182 - 11735744) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000101613 Chr11:11729105..11729181 No primer for this exon
downstream ENSMUSE00000470789 Chr11:11724852..11724871 No primer for this exon
downstream ENSMUSE00000444751 Chr11:11722198..11722296 No primer for this exon
downstream ENSMUSE00000329824 Chr11:11719294..11719395 No primer for this exon
downstream ENSMUSE00000472083 Chr11:11715214..11715431 No primer for this exon
downstream ENSMUSE00000681137 Chr11:11714106..11714520 No primer for this exon
downstream ENSMUSE00000474889 Chr11:11714104..11714520 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TACTGCAGTGCCAGGGTCTT Chr11:11732769..11732789 60.85 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGTGTAAAGCCCAGGATGG Chr11:11732743..11732763 60.51 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TGGAAATCAAAGGCAAAACC Chr11:11732808..11732828 59.92 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TGGAAATCAAAGGCAAAACC Chr11:11732808..11732828 59.92 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020182