Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21464
Trapped Gene
Col13a1 (ENSMUSG00000058806)
Vector Insertion
Chr 10: 61313859 - 61313914
Public Clones not available
Private Clones OST329543 (lexicon)
Severity of mutation (?) Insertion after 84% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000643152 (Chr10:61313860..61313913 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000643152 (Chr10:61313860..61313913 -)
Downstram Exon
ENSMUSE00000643131 (Chr10:61313860..61313913 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000463034 Chr10:61441097..61441821 TCATTTTCGGTCCTCTTTGG Chr10:61441518..61441537 60.04 45
upstream ENSMUSE00000708439 Chr10:61441097..61441856 TCATTTTCGGTCCTCTTTGG Chr10:61441518..61441537 60.04 45
upstream ENSMUSE00000722030 Chr10:61441097..61441856 TCATTTTCGGTCCTCTTTGG Chr10:61441518..61441537 60.04 45
upstream ENSMUSE00000643124 Chr10:61440461..61440869 TGCCTGGTTTTATGGTCACA Chr10:61440710..61440729 59.96 45
upstream ENSMUSE00000100461 Chr10:61424037..61424106 AGGATGTAACTGCCCACCAG Chr10:61424037..61424056 59.99 55
upstream ENSMUSE00000666267 Chr10:61424037..61424106 AGGATGTAACTGCCCACCAG Chr10:61424037..61424056 59.99 55
upstream ENSMUSE00000643176 Chr10:61382837..61382844 No primer for this exon
upstream ENSMUSE00000576025 Chr10:61374455..61374481 CCACTGGAAGACCTGGACTC Chr10:61374458..61374477 59.68 60
upstream ENSMUSE00000666266 Chr10:61374455..61374489 CCACTGGAAGACCTGGACTC Chr10:61374458..61374477 59.68 60
upstream ENSMUSE00000100457 Chr10:61371430..61371465 No primer for this exon
upstream ENSMUSE00000100467 Chr10:61368002..61368028 No primer for this exon
upstream ENSMUSE00000514474 Chr10:61365838..61365888 No primer for this exon
upstream ENSMUSE00000420529 Chr10:61359887..61359922 AGCCTGGTACCCGAGGTTTC Chr10:61359899..61359918 62.65 60
upstream ENSMUSE00000576023 Chr10:61359094..61359120 No primer for this exon
upstream ENSMUSE00000576022 Chr10:61358082..61358108 No primer for this exon
upstream ENSMUSE00000100480 Chr10:61356782..61356808 No primer for this exon
upstream ENSMUSE00000481885 Chr10:61356663..61356689 CTCAGGGACAAAAGGGAGAA Chr10:61356666..61356685 59.26 50
upstream ENSMUSE00000482853 Chr10:61355704..61355730 No primer for this exon
upstream ENSMUSE00000100454 Chr10:61353956..61354012 CCAACCCGATAATGTCCCTA Chr10:61353959..61353978 59.64 50
upstream ENSMUSE00000100456 Chr10:61352827..61352892 TCCACCCCCAGTCATTAAAA Chr10:61352841..61352860 60.16 45
upstream ENSMUSE00000100479 Chr10:61349997..61350104 AGTCAGACTGGCATCCAAGG Chr10:61350076..61350095 60.26 55
upstream ENSMUSE00000100453 Chr10:61348436..61348462 No primer for this exon
upstream ENSMUSE00000100450 Chr10:61347424..61347459 CAGGGATCCAGGGCTATCAT Chr10:61347433..61347452 61.2 55
upstream ENSMUSE00000666270 Chr10:61340947..61341140 AGACAAACCGAAGCCTCTGA Chr10:61340966..61340985 59.99 50
upstream ENSMUSE00000378731 Chr10:61339016..61339060 No primer for this exon
upstream ENSMUSE00000576021 Chr10:61337486..61337518 No primer for this exon
upstream ENSMUSE00000576020 Chr10:61336742..61336768 No primer for this exon
upstream ENSMUSE00000576019 Chr10:61334038..61334082 No primer for this exon
upstream ENSMUSE00000100451 Chr10:61332909..61332995 AAAAAGGTGATGCTGGCAAT Chr10:61332972..61332991 59.57 40
upstream ENSMUSE00000576018 Chr10:61332272..61332325 GGAGAAGCTGGTGTTGATGG Chr10:61332306..61332325 60.66 55
upstream ENSMUSE00000100477 Chr10:61330579..61330623 No primer for this exon
upstream ENSMUSE00000100476 Chr10:61330200..61330268 GCAAAGGAGAGATGGTGGAT Chr10:61330230..61330249 59.09 50
upstream ENSMUSE00000468595 Chr10:61329139..61329162 No primer for this exon
upstream ENSMUSE00000274964 Chr10:61326689..61326751 TCCTGGTCTTCCTGGACAAA Chr10:61326727..61326746 60.62 50
upstream ENSMUSE00000100473 Chr10:61325792..61325836 No primer for this exon
upstream ENSMUSE00000576005 Chr10:61325496..61325519 No primer for this exon
upstream ENSMUSE00000518217 Chr10:61325376..61325519 AGGAAGTCCAGGGGAGAAAG Chr10:61325402..61325421 59.67 55
upstream ENSMUSE00000576004 Chr10:61325376..61325490 AGGAAGTCCAGGGGAGAAAG Chr10:61325402..61325421 59.67 55
upstream ENSMUSE00000100452 Chr10:61324763..61324861 AAGGAGAACCAGGTGACGAA Chr10:61324817..61324836 59.7 50
upstream ENSMUSE00000643138 Chr10:61323188..61323232 AAAGGAGAAGCTGGGGAGAA Chr10:61323207..61323226 60.32 50
upstream ENSMUSE00000643158 Chr10:61323188..61323232 AAAGGAGAAGCTGGGGAGAA Chr10:61323207..61323226 60.32 50
upstream ENSMUSE00000643136 Chr10:61320336..61320377 No primer for this exon
upstream ENSMUSE00000643155 Chr10:61320336..61320377 No primer for this exon
upstream ENSMUSE00000643134 Chr10:61319530..61319556 CAAGGTTTTCCTGGACCAAA Chr10:61319531..61319550 59.94 45
upstream ENSMUSE00000643154 Chr10:61319530..61319556 CAAGGTTTTCCTGGACCAAA Chr10:61319531..61319550 59.94 45
upstream ENSMUSE00000643133 Chr10:61319086..61319166 GGCCTAGAGGGCAGTAAAGG Chr10:61319138..61319157 60.22 60
upstream ENSMUSE00000643153 Chr10:61319086..61319166 GGCCTAGAGGGCAGTAAAGG Chr10:61319138..61319157 60.22 60
upstream ENSMUSE00000576013 Chr10:61316105..61316140 No primer for this exon
upstream ENSMUSE00000643131 Chr10:61313860..61313913 No primer for this exon
upstream ENSMUSE00000643152 Chr10:61313860..61313913 No primer for this exon

*** Putative Vector Insertion (Chr 10: 61313859 - 61313914) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000643129 Chr10:61312905..61312958 No primer for this exon
downstream ENSMUSE00000643151 Chr10:61312905..61312958 No primer for this exon
downstream ENSMUSE00000643128 Chr10:61311924..61311959 No primer for this exon
downstream ENSMUSE00000643150 Chr10:61311924..61311959 No primer for this exon
downstream ENSMUSE00000666265 Chr10:61311804..61311959 GCACGAGGGCTCAGACTTAC Chr10:61311882..61311901 60.02 60
downstream ENSMUSE00000420534 Chr10:61311480..61311959 GCACGAGGGCTCAGACTTAC Chr10:61311882..61311901 60.02 60
downstream ENSMUSE00000643127 Chr10:61306316..61306402 GCCCTCTAGAGCCCTTCTTC Chr10:61306350..61306369 59.56 60
downstream ENSMUSE00000643149 Chr10:61306316..61306402 GCCCTCTAGAGCCCTTCTTC Chr10:61306350..61306369 59.56 60
downstream ENSMUSE00000643126 Chr10:61302826..61302864 CCTTGGACTGGTAAGCCATC Chr10:61302817..61302836 59.55 55
downstream ENSMUSE00000643148 Chr10:61302826..61302864 CCTTGGACTGGTAAGCCATC Chr10:61302817..61302836 59.55 55
downstream ENSMUSE00000666264 Chr10:61301246..61301456 GTCCCAGGTTAGAGGCATCA Chr10:61301415..61301434 60.07 55
downstream ENSMUSE00000666271 Chr10:61301246..61301456 GTCCCAGGTTAGAGGCATCA Chr10:61301415..61301434 60.07 55
downstream ENSMUSE00000576010 Chr10:61300984..61301456 TGCAACATTAGGAGCAGACG Chr10:61301192..61301211 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr10:61313844..61313864 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTCTGCTTCCTTTCACCTC Chr10:61313917..61313937 59.01 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000058806