Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21475
Trapped Gene
Cep57 (ENSMUSG00000031922)
Vector Insertion
Chr 9: 13626128 - 13631299
Public Clones (sanger) (sanger) (ggtc) E025G03 (ggtc) (ggtc) D106B04 (ggtc)
Private Clones OST329348 (lexicon) OST316338 (lexicon) OST258023 (lexicon) OST139094 (lexicon)
OST126926 (lexicon) OST58868 (lexicon) OST50138 (lexicon) OST36629 (lexicon)
OST36610 (lexicon) OST34137 (lexicon) OST32658 (lexicon)
Severity of mutation (?) Insertion after 3% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000311912 (Chr9:13631300..13631433 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCGGCTTCTGATTCTCAGTT Chr9:13631304..13631323 59.58 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000311912 (Chr9:13631300..13631433 -)
Downstram Exon
ENSMUSE00000539746 (Chr9:13625971..13626127 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCGGCTTCTGATTCTCAGTT Chr9:13631304..13631323 59.58 50 TTATTTGGGGAGCGTCTCAG Chr9:13625984..13626003 60.21 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000311912 Chr9:13631300..13631433 GCGGCTTCTGATTCTCAGTT Chr9:13631304..13631323 59.58 50

*** Putative Vector Insertion (Chr 9: 13626128 - 13631299) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000539746 Chr9:13625971..13626127 TTATTTGGGGAGCGTCTCAG Chr9:13625984..13626003 60.21 50
downstream ENSMUSE00000311872 Chr9:13623303..13623482 TCCAGGCGTCGAATCTTATC Chr9:13623412..13623431 60.18 50
downstream ENSMUSE00000539745 Chr9:13622767..13622888 No primer for this exon
downstream ENSMUSE00000214672 Chr9:13621331..13621447 ATCATGCTGCCGTTCTCTTT Chr9:13621396..13621415 59.84 45
downstream ENSMUSE00000214669 Chr9:13620499..13620576 CCTGCTCTTCTTCACGGAGT Chr9:13620509..13620528 59.6 55
downstream ENSMUSE00000214675 Chr9:13617854..13617964 AGTGCTGGTTGAAACACATGA Chr9:13617871..13617891 59.2 42.86
downstream ENSMUSE00000214670 Chr9:13617077..13617154 GTAATGTGGCTGTGCACCAA Chr9:13617094..13617113 60.58 50
downstream ENSMUSE00000214679 Chr9:13615071..13615306 CATTTGCCCAAATTCATCCT Chr9:13615054..13615073 59.76 40
downstream ENSMUSE00000214677 Chr9:13614304..13614448 ATGCCTCCAATTCACACTCC Chr9:13614344..13614363 59.93 50
downstream ENSMUSE00000539736 Chr9:13612227..13613284 TCTCTGTTTGGCCAGATCCT Chr9:13613125..13613144 59.8 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCTGTACGGCTCTCCGTAAT Chr9:13631244..13631264 59.22 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCTTCTGATTCTCAGTTTTCG Chr9:13631298..13631320 60.37 45.46 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TGTCGAATCCGGAGGATAAT Chr9:13631379..13631399 59.34 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TGTTTGGAAGAGGGAAGAGC Chr9:13631451..13631471 59.4 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031922