Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21488
Trapped Gene
Wdr34 (ENSMUSG00000039715)
Vector Insertion
Chr 2: 29890393 - 29893694
Public Clones not available
Private Clones OST329091 (lexicon) OST292088 (lexicon) OST210417 (lexicon) OST167002 (lexicon)
OST132934 (lexicon)
Severity of mutation (?) Insertion after 7% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000286799 (Chr2:29893695..29893946 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATGCCTTCGATGGCTATGAG Chr2:29893722..29893741 60.2 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000286799 (Chr2:29893695..29893946 -)
Downstram Exon
ENSMUSE00000286790 (Chr2:29890283..29890392 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATGCCTTCGATGGCTATGAG Chr2:29893722..29893741 60.2 50 ACAGAGCCTGTCGAGTTCCA Chr2:29890282..29890301 61.01 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000711889 Chr2:29904204..29904399 No primer for this exon
upstream ENSMUSE00000714590 Chr2:29904204..29904399 No primer for this exon
upstream ENSMUSE00000286799 Chr2:29893695..29893946 ATGCCTTCGATGGCTATGAG Chr2:29893722..29893741 60.2 50
upstream ENSMUSE00000696764 Chr2:29893695..29893946 ATGCCTTCGATGGCTATGAG Chr2:29893722..29893741 60.2 50

*** Putative Vector Insertion (Chr 2: 29890393 - 29893694) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000286790 Chr2:29890283..29890392 ACAGAGCCTGTCGAGTTCCA Chr2:29890282..29890301 61.01 55
downstream ENSMUSE00000286778 Chr2:29889326..29889483 CACCACTACTGATGGCTGCT Chr2:29889365..29889384 58.91 55
downstream ENSMUSE00000286767 Chr2:29888794..29888903 TGTCAGACCTGTACGCCAAA Chr2:29888802..29888821 60.3 50
downstream ENSMUSE00000286759 Chr2:29888270..29888437 AGAGCAACACCTTGCCATCT Chr2:29888337..29888356 59.87 50
downstream ENSMUSE00000286753 Chr2:29887922..29888154 ACGAAAAGGCTGGAGTCAAA Chr2:29888062..29888081 59.85 45
downstream ENSMUSE00000286744 Chr2:29887593..29887750 CAGTGAGGTAAGGGGCTGAG Chr2:29887650..29887669 59.86 60
downstream ENSMUSE00000337969 Chr2:29887159..29887492 TGATCCAAGTCCTCCACCTC Chr2:29887257..29887276 60.05 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGAACTGGACTGAGCAGCA Chr2:29890700..29890720 60.19 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGCTATGAGGTGAACTGGA Chr2:29893710..29893730 59.24 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039715