Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21491
Trapped Gene
Grinl1a (ENSMUSG00000032199)
Vector Insertion
Chr 9: 71331613 - 71333490
Public Clones (egtc)
Private Clones OST329055 (lexicon) OST179660 (lexicon)
Severity of mutation (?) Insertion after 10% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000359143 (Chr9:71333491..71333723 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000359143 (Chr9:71333491..71333723 -)
Downstram Exon
ENSMUSE00000217613 (Chr9:71330974..71331612 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GAGGGTTCACTCTGGTCTGC Chr9:71331084..71331103 59.84 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000359143 Chr9:71333491..71333723 No primer for this exon

*** Putative Vector Insertion (Chr 9: 71331613 - 71333490) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000217613 Chr9:71330974..71331612 GAGGGTTCACTCTGGTCTGC Chr9:71331084..71331103 59.84 60
downstream ENSMUSE00000217616 Chr9:71329149..71329353 AGGGCCAGCGACTCTTCTAT Chr9:71329155..71329174 60.37 55
downstream ENSMUSE00000217615 Chr9:71326278..71327347 TTCAGTCTCTCGGCCAGTTT Chr9:71327279..71327298 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGAACCGTGACTGGGAAAAC Chr9:71333424..71333444 61.69 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032199