Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21503
Trapped Gene
Arfgef2 (ENSMUSG00000074582)
Vector Insertion
Chr 2: 166715938 - 166717266
Public Clones not available
Private Clones OST328680 (lexicon)
Severity of mutation (?) Insertion after 92% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000639068 (Chr2:166715769..166715937 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CACATCGAGACGGAGAATCA Chr2:166715793..166715812 59.79 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000639068 (Chr2:166715769..166715937 +)
Downstram Exon
ENSMUSE00000639067 (Chr2:166717267..166717405 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CACATCGAGACGGAGAATCA Chr2:166715793..166715812 59.79 50 GCGGTTCTCATCAACGTACA Chr2:166717370..166717389 59.72 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000639110 Chr2:166631215..166631335 AGCTGACAAGGAGGTGAAGC Chr2:166631271..166631290 59.6 55
upstream ENSMUSE00000639109 Chr2:166652427..166652457 No primer for this exon
upstream ENSMUSE00000639108 Chr2:166653042..166653165 CTGCCAATCCAAGTCACCTC Chr2:166653114..166653133 60.66 55
upstream ENSMUSE00000639107 Chr2:166659971..166660117 TGATCGACAGGATCGTTGAA Chr2:166660035..166660054 60.2 45
upstream ENSMUSE00000639106 Chr2:166661113..166661292 TATCTGGCCAGCAAAAACCT Chr2:166661197..166661216 59.71 45
upstream ENSMUSE00000639105 Chr2:166661702..166661957 AGAAGCTCCCCGAGAGAGAG Chr2:166661902..166661921 60.23 60
upstream ENSMUSE00000639104 Chr2:166668185..166668253 GAGCTCAGGAGGTGGTGAAG Chr2:166668197..166668216 59.99 60
upstream ENSMUSE00000639103 Chr2:166670950..166671101 GACAGGCAGTCGCTATCCTC Chr2:166671069..166671088 59.98 60
upstream ENSMUSE00000639102 Chr2:166674367..166674497 CCAAGTGGCTGCTAGGTTCT Chr2:166674387..166674406 59.5 55
upstream ENSMUSE00000639101 Chr2:166676543..166676777 AAGAATGGCGTGTCCTCAGT Chr2:166676676..166676695 59.73 50
upstream ENSMUSE00000639100 Chr2:166677455..166677554 GACCCTGACGAGGATTTGTG Chr2:166677532..166677551 60.51 55
upstream ENSMUSE00000639099 Chr2:166678755..166678894 AGCTGGGGATGACACCTCTA Chr2:166678872..166678891 59.68 55
upstream ENSMUSE00000639098 Chr2:166680405..166680513 TATGTGAATCCCAACCACCA Chr2:166680483..166680502 59.62 45
upstream ENSMUSE00000639097 Chr2:166681907..166682090 CAGACAGCCATTCAGGATGA Chr2:166682011..166682030 59.79 50
upstream ENSMUSE00000639096 Chr2:166684763..166684874 TAAGAAGCCCAAGCGAGGTA Chr2:166684769..166684788 59.97 50
upstream ENSMUSE00000639095 Chr2:166685286..166685491 GGGAGACAGCACGAGGTTTA Chr2:166685306..166685325 60.26 55
upstream ENSMUSE00000639094 Chr2:166685814..166685898 GTTTGCTAGTGCGGACACTG Chr2:166685823..166685842 59.51 55
upstream ENSMUSE00000679594 Chr2:166686025..166686196 CACACAATTGCGACCAAGTC Chr2:166686166..166686185 60.16 50
upstream ENSMUSE00000679593 Chr2:166687084..166687235 TGGAGCAGATGGCTAAAACA Chr2:166687129..166687148 59.42 45
upstream ENSMUSE00000679591 Chr2:166689057..166689185 GTGTTTGGAAGGCATCAGGT Chr2:166689131..166689150 59.97 50
upstream ENSMUSE00000639093 Chr2:166690193..166690351 ATGGCAACTACCTTGGCAAC Chr2:166690320..166690339 60 50
upstream ENSMUSE00000639092 Chr2:166691180..166691327 GGGGTGAAGACTCGCTACCT Chr2:166691228..166691247 60.65 60
upstream ENSMUSE00000639091 Chr2:166692412..166692511 CAGAGTGTGGTTGTCGCAGT Chr2:166692486..166692505 59.94 55
upstream ENSMUSE00000639090 Chr2:166692646..166692686 ACCAGACTGGATGGAAATGC Chr2:166692662..166692681 59.93 50
upstream ENSMUSE00000639089 Chr2:166692788..166692957 ACCATCCTCGAATGTTCAGC Chr2:166692842..166692861 60.08 50
upstream ENSMUSE00000639088 Chr2:166694392..166694543 GCCATCTTCGCAGTTGACTC Chr2:166694419..166694438 60.96 55
upstream ENSMUSE00000639087 Chr2:166695710..166695882 TCTTTGCTGTGTTCCACCAG Chr2:166695799..166695818 59.87 50
upstream ENSMUSE00000639084 Chr2:166696959..166697119 TCCGCTTCTGTGGGAAATAC Chr2:166697082..166697101 60.07 50
upstream ENSMUSE00000639081 Chr2:166699076..166699206 AATGTGGCTCCTGGTGACAG Chr2:166699106..166699125 61.13 55
upstream ENSMUSE00000639078 Chr2:166699363..166699492 GGACTCACGGTCATGTTTGA Chr2:166699364..166699383 59.53 50
upstream ENSMUSE00000639076 Chr2:166701993..166702128 ACGAAGCTTTGCATGAAGTG Chr2:166702063..166702082 59.08 45
upstream ENSMUSE00000639073 Chr2:166703771..166703909 GAAGTTCAGCCCTGCTGTCT Chr2:166703835..166703854 59.6 55
upstream ENSMUSE00000639071 Chr2:166704018..166704072 TGGAGGAGGAGGTGTCAGAT Chr2:166704044..166704063 59.64 55
upstream ENSMUSE00000639070 Chr2:166706672..166706786 GACCGCCAGTCTTTAAGCAG Chr2:166706684..166706703 60.01 55
upstream ENSMUSE00000639069 Chr2:166711279..166711409 CCAGACCATTGACAACATCG Chr2:166711334..166711353 59.96 50
upstream ENSMUSE00000639068 Chr2:166715769..166715937 CACATCGAGACGGAGAATCA Chr2:166715793..166715812 59.79 50

*** Putative Vector Insertion (Chr 2: 166715938 - 166717266) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000639067 Chr2:166717267..166717405 GCGGTTCTCATCAACGTACA Chr2:166717370..166717389 59.72 50
downstream ENSMUSE00000639065 Chr2:166719001..166719118 ATGGCTCTCGGAGTTCACAG Chr2:166719055..166719074 60.41 55
downstream ENSMUSE00000639063 Chr2:166720112..166720671 TAGAGGAAACGGTGGCATTC Chr2:166720559..166720578 60.07 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr2:166715988..166716008 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAACTATGAGCAGCGGACTGT Chr2:166715904..166715925 60.47 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000074582