Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2151
Trapped Gene
Ppp1r10 (ENSMUSG00000039220)
Vector Insertion
Chr 17: 36053544 - 36054140
Public Clones XT0756 (sanger) (sanger) (sanger) D004C09 (ggtc) D004C09 (ggtc)
5SP146H05 (ggtc) P106F02 (ggtc) PST11944-NL (escells) PST13897-NL (escells)
PST292-1 (escells) PST13504-NL (escells) PST5635-NL (escells) PSTVU01.5A2 (vanderbilt)
IST14384C7 (tigm) IST10893G2 (tigm)
Private Clones OST431936 (lexicon) OST266921 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000696938 (Chr17:36053511..36053543 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGACCAGTCACGATGAATCC Chr17:36053513..36053532 60.33 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000696938 (Chr17:36053511..36053543 +)
Downstram Exon
ENSMUSE00000544178 (Chr17:36054141..36054661 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGACCAGTCACGATGAATCC Chr17:36053513..36053532 60.33 55 ATTCCAAAACGGAAATGCTG Chr17:36054437..36054456 59.94 40

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000696938 Chr17:36053511..36053543 GGACCAGTCACGATGAATCC Chr17:36053513..36053532 60.33 55

*** Putative Vector Insertion (Chr 17: 36053544 - 36054140) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000544178 Chr17:36054141..36054661 ATTCCAAAACGGAAATGCTG Chr17:36054437..36054456 59.94 40
downstream ENSMUSE00000696937 Chr17:36054143..36054661 ATTCCAAAACGGAAATGCTG Chr17:36054437..36054456 59.94 40
downstream ENSMUSE00000401990 Chr17:36060253..36060370 CTTTGGGGTCTATGGGACCT Chr17:36060294..36060313 60.18 55
downstream ENSMUSE00000710787 Chr17:36060253..36060370 CTTTGGGGTCTATGGGACCT Chr17:36060294..36060313 60.18 55
downstream ENSMUSE00000271882 Chr17:36060982..36061068 TCTTTCGTGCCTCCTTCATT Chr17:36061007..36061026 59.81 45
downstream ENSMUSE00000271851 Chr17:36061190..36061325 CTTGTAGCCACCGACATCAA Chr17:36061217..36061236 59.72 50
downstream ENSMUSE00000271828 Chr17:36061803..36061854 TTGACTTGCTGAGCTGCTTC Chr17:36061845..36061864 59.47 50
downstream ENSMUSE00000354294 Chr17:36063147..36063224 CTACTCTGGGAGCGGATGAC Chr17:36063213..36063232 59.83 60
downstream ENSMUSE00000271739 Chr17:36063345..36063518 ATGACTGGGTGCCGTAGTTC Chr17:36063502..36063521 60 55
downstream ENSMUSE00000271719 Chr17:36063717..36063822 TCTTCTTCACAGGCACCAAA Chr17:36063761..36063780 59.42 45
downstream ENSMUSE00000271697 Chr17:36063919..36064031 GGCTGTGTTGAGAGGCTTGT Chr17:36063988..36064007 60.45 55
downstream ENSMUSE00000271680 Chr17:36064855..36064955 GCAGTCGGCGATAGTACCTT Chr17:36064951..36064970 59.36 55
downstream ENSMUSE00000271660 Chr17:36065127..36065274 CTCTGCTCGGTGCTTGTTTT Chr17:36065167..36065186 60.57 50
downstream ENSMUSE00000271647 Chr17:36065348..36065506 CCTCAGGCCAAGTCACAGTT Chr17:36065458..36065477 60.3 55
downstream ENSMUSE00000271631 Chr17:36065597..36065843 GATGTATCGCTCCTGGCTGT Chr17:36065793..36065812 60.25 55
downstream ENSMUSE00000271611 Chr17:36066166..36066229 ATGGGTTCATATGGCTCAGG Chr17:36066204..36066223 59.77 50
downstream ENSMUSE00000271590 Chr17:36066337..36066531 CTCCCATGCTTCCCATAAGA Chr17:36066466..36066485 60.03 50
downstream ENSMUSE00000271566 Chr17:36066718..36066793 CAGCATCTGCTTGAGCTTGT Chr17:36066795..36066814 59.34 50
downstream ENSMUSE00000271539 Chr17:36066996..36067109 GAAATGCTGCATACCCTTCG Chr17:36067084..36067103 60.61 50
downstream ENSMUSE00000401389 Chr17:36067237..36067554 GTGGTGGGGGACCTAAGAGA Chr17:36067296..36067315 61.28 60
downstream ENSMUSE00000544177 Chr17:36067237..36067836 GACATCATGTGGTCGGTGTC Chr17:36067724..36067743 59.81 55
downstream ENSMUSE00000544180 Chr17:36067597..36067836 GACATCATGTGGTCGGTGTC Chr17:36067724..36067743 59.81 55
downstream ENSMUSE00000544175 Chr17:36068094..36069217 TGTTCTCATAGCGGCAGTTG Chr17:36068159..36068178 60.01 50
downstream ENSMUSE00000544179 Chr17:36068094..36068203 TGTTCTCATAGCGGCAGTTG Chr17:36068159..36068178 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATTTCTCCCGGACCAGTCAC Chr17:36053505..36053525 61.29 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATTTCTCCCGGACCAGTCAC Chr17:36053505..36053525 61.29 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039220