Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21518
Trapped Gene
Wdr57 (ENSMUSG00000074088)
Vector Insertion
Chr 4: 130060762 - 130061728
Public Clones not available
Private Clones OST327393 (lexicon)
Severity of mutation (?) Insertion after 72% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000668166 (Chr4:130060641..130060761 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGGCCTGAGCTTGAGTTCT Chr4:130060702..130060721 59.74 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000668166 (Chr4:130060641..130060761 +)
Downstram Exon
ENSMUSE00000668165 (Chr4:130061729..130061811 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGGCCTGAGCTTGAGTTCT Chr4:130060702..130060721 59.74 55 CTCTCTTTGGGAGCAAATGG Chr4:130061771..130061790 59.81 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000668172 Chr4:130037416..130037596 ATCGAGCAGCAGAAGCGTAA Chr4:130037456..130037475 61.21 50
upstream ENSMUSE00000668171 Chr4:130039875..130040004 GAGGGGGAAGTGTACTGCTG Chr4:130039929..130039948 59.72 60
upstream ENSMUSE00000668170 Chr4:130042322..130042415 AAGGGACACAGTGGAGCAGT Chr4:130042366..130042385 59.76 55
upstream ENSMUSE00000634363 Chr4:130045436..130045601 TCAGCGTCGACAGACAAAAC Chr4:130045446..130045465 60.03 50
upstream ENSMUSE00000668160 Chr4:130050589..130050633 No primer for this exon
upstream ENSMUSE00000668167 Chr4:130055293..130055415 GCAGCTGTCCAGACATTTCA Chr4:130055314..130055333 59.99 50
upstream ENSMUSE00000668166 Chr4:130060641..130060761 CTGGCCTGAGCTTGAGTTCT Chr4:130060702..130060721 59.74 55

*** Putative Vector Insertion (Chr 4: 130060762 - 130061728) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000668165 Chr4:130061729..130061811 CTCTCTTTGGGAGCAAATGG Chr4:130061771..130061790 59.81 50
downstream ENSMUSE00000668163 Chr4:130063201..130063262 CCAGCTGCTATCTTGCTTCC Chr4:130063253..130063272 60.12 55
downstream ENSMUSE00000668162 Chr4:130065823..130065926 GTGGTGTCCCACACGTACAC Chr4:130065849..130065868 59.76 60
downstream ENSMUSE00000668161 Chr4:130066792..130067165 ATGGTCATCTGAGGCAGGTC Chr4:130066945..130066964 60.08 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTCTTCTGGGGCCTTTAAC Chr4:130060779..130060799 60.21 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTCTTCTGGGGCCTTTAAC Chr4:130060779..130060799 60.21 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000074088