Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21531
Trapped Gene
Armcx5 (ENSMUSG00000072969)
Vector Insertion
Chr X: 132279115 - 132279457
Public Clones (sanger)
Private Clones OST326785 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000715163 (ChrX:132279038..132279114 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGGAGGAAACAATCCCTTGG ChrX:132279084..132279103 60.3 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000715163 (ChrX:132279038..132279114 +)
Downstram Exon
ENSMUSE00000622527 (ChrX:132279458..132281859 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGGAGGAAACAATCCCTTGG ChrX:132279084..132279103 60.3 50 GCGCTTATCAGTAGCCTTGG ChrX:132280150..132280169 60 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000454164 ChrX:132277231..132277517 AGGAGTGGGTACCGAAAGGT ChrX:132277299..132277318 59.86 55
upstream ENSMUSE00000711023 ChrX:132278102..132278153 CTCCGCGTTACCCCAACTAT ChrX:132278117..132278136 61.24 55
upstream ENSMUSE00000715163 ChrX:132279038..132279114 AGGAGGAAACAATCCCTTGG ChrX:132279084..132279103 60.3 50

*** Putative Vector Insertion (Chr X: 132279115 - 132279457) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000622527 ChrX:132279458..132281859 GCGCTTATCAGTAGCCTTGG ChrX:132280150..132280169 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGGGACTCCTCGAGTAAGA ChrX:132279129..132279149 59.8 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGGGACTCCTCGAGTAAGA ChrX:132279129..132279149 59.8 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000072969