Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21552
Trapped Gene
Tmtc1 (ENSMUSG00000030306)
Vector Insertion
Chr 6: 148233493 - 148243036
Public Clones not available
Private Clones OST326201 (lexicon)
Severity of mutation (?) Insertion after 57% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000275629 (Chr6:148243037..148243204 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGCTGTCGAGAGAGTCCTT Chr6:148243043..148243062 60.13 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000275629 (Chr6:148243037..148243204 -)
Downstram Exon
ENSMUSE00000650109 (Chr6:148233379..148233492 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGCTGTCGAGAGAGTCCTT Chr6:148243043..148243062 60.13 55 AGGGCGGTTCTGTAGTGGTA Chr6:148233360..148233379 59.62 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000650123 Chr6:148392423..148392845 CTAACGACTTCTGGGGCAAG Chr6:148392482..148392501 59.87 55
upstream ENSMUSE00000650122 Chr6:148374329..148374506 GTCTTCAAGAATCGCGGACT Chr6:148374381..148374400 59.43 50
upstream ENSMUSE00000650120 Chr6:148364232..148364305 CTAGCATGCCTCCTGTTCCT Chr6:148364256..148364275 59.45 55
upstream ENSMUSE00000650118 Chr6:148361164..148361340 ATGCTGGTGAAGGAGACAGG Chr6:148361230..148361249 60.26 55
upstream ENSMUSE00000650116 Chr6:148359560..148359763 GCTTCCCACACAAAGACTCC Chr6:148359646..148359665 59.7 55
upstream ENSMUSE00000650115 Chr6:148284773..148284854 GTTTTTAAAGCGGGCCATTT Chr6:148284787..148284806 60.31 40
upstream ENSMUSE00000197286 Chr6:148284165..148284268 ATTTCCGCCTGTGGATAATG Chr6:148284233..148284252 59.78 45
upstream ENSMUSE00000197278 Chr6:148273639..148273828 TGGGAAGTATCCCTCTGGTG Chr6:148273729..148273748 59.92 55
upstream ENSMUSE00000197285 Chr6:148254520..148254641 GTGGCCGAGAGAGTCCTGTA Chr6:148254529..148254548 60.41 60
upstream ENSMUSE00000275629 Chr6:148243037..148243204 TGGCTGTCGAGAGAGTCCTT Chr6:148243043..148243062 60.13 55

*** Putative Vector Insertion (Chr 6: 148233493 - 148243036) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000650109 Chr6:148233379..148233492 AGGGCGGTTCTGTAGTGGTA Chr6:148233360..148233379 59.62 55
downstream ENSMUSE00000197282 Chr6:148219898..148220041 TTCCCCAGATTGAAAAGTGC Chr6:148219885..148219904 60.05 45
downstream ENSMUSE00000197302 Chr6:148211305..148211413 GCCAAGCTTGAATAGGCATC Chr6:148211302..148211321 59.81 50
downstream ENSMUSE00000197292 Chr6:148198010..148198112 TTCCAGCCTGGTAAATGTCC Chr6:148198051..148198070 59.93 50
downstream ENSMUSE00000275608 Chr6:148195925..148196060 GGTAGTGAGCCACAGCCTTC Chr6:148196009..148196028 59.87 60
downstream ENSMUSE00000275601 Chr6:148195256..148195400 AGCTTCCCTGTACACCTCCA Chr6:148195276..148195295 59.72 55
downstream ENSMUSE00000197288 Chr6:148194233..148194370 TTTGGTCTGACCCATCACTG Chr6:148194316..148194335 59.52 50
downstream ENSMUSE00000197296 Chr6:148193206..148193328 TCAAAAGCTTTGTCCAGAAGG Chr6:148193185..148193205 59.48 42.86
downstream ENSMUSE00000197284 Chr6:148191710..148191787 GTCAGGATCCAGGGTCACAG Chr6:148191733..148191752 60.53 60
downstream ENSMUSE00000379302 Chr6:148185119..148186456 AGTGATAATCTGGGCGATGC Chr6:148185771..148185790 60.07 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCAGAATGAAATCTGGCTGTC Chr6:148237053..148237074 59.83 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CACTCCGTGACTGGGAAAAC Chr6:148236970..148236990 60.54 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030306