Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21556
Trapped Gene
BC052040 (ENSMUSG00000040282)
Vector Insertion
Chr 2: 115464801 - 115468399
Public Clones not available
Private Clones OST326123 (lexicon)
Severity of mutation (?) Insertion after 32% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000435640 (Chr2:115464740..115464800 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000435640 (Chr2:115464740..115464800 +)
Downstram Exon
ENSMUSE00000296980 (Chr2:115468400..115468472 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GAGTCTGTTCATGCCCCTGT Chr2:115468472..115468491 60.12 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000435687 Chr2:115407512..115407721 CTCTGCCCTTCCCTAGGTTC Chr2:115407551..115407570 60.2 60
upstream ENSMUSE00000435652 Chr2:115456741..115456786 GCCACTCTGCTGAGCATCTT Chr2:115456751..115456770 60.71 55
upstream ENSMUSE00000435646 Chr2:115457672..115457736 CACACTCCAGAAGCGATTGA Chr2:115457702..115457721 59.98 50
upstream ENSMUSE00000435640 Chr2:115464740..115464800 No primer for this exon

*** Putative Vector Insertion (Chr 2: 115464801 - 115468399) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000296980 Chr2:115468400..115468472 GAGTCTGTTCATGCCCCTGT Chr2:115468472..115468491 60.12 55
downstream ENSMUSE00000296970 Chr2:115495318..115495397 GTCCCGCAGCATACTGTTTA Chr2:115495355..115495374 58.8 50
downstream ENSMUSE00000296963 Chr2:115495745..115495794 AGCGGTCCATAGCAACAGTC Chr2:115495779..115495798 60.28 55
downstream ENSMUSE00000296958 Chr2:115500462..115500529 CAGGACTTCATGCTCATAGCC Chr2:115500491..115500511 59.85 52.38
downstream ENSMUSE00000296953 Chr2:115512121..115512186 TGAAGTCTGGGGTTTTGTCA Chr2:115512171..115512190 59.11 45
downstream ENSMUSE00000296948 Chr2:115512800..115512905 GTAGGCGTGGTGGCTACATT Chr2:115512876..115512895 60.02 55
downstream ENSMUSE00000685896 Chr2:115602638..115604504 AGGTTATTCCCCGGTAATGC Chr2:115603278..115603297 60.04 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGAAAATAATCGCCTTGCAG Chr2:115467846..115467866 58.91 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGCTGGCCAATGAGGTAAT Chr2:115467787..115467807 59.15 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040282