Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21560
Trapped Gene
OTTMUSG00000016577 (ENSMUSG00000078869)
Vector Insertion
Chr 2: 177049358 - 177050314
Public Clones not available
Private Clones OST326043 (lexicon) OST288690 (lexicon)
Severity of mutation (?) Insertion after 9% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000714365 (Chr2:177049359..177050313 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCACAAAGCAGTCATCTCCA Chr2:177049981..177050000 59.99 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000714365 (Chr2:177049359..177050313 -)
Downstram Exon
ENSMUSE00000709498 (Chr2:177049359..177050313 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCACAAAGCAGTCATCTCCA Chr2:177049981..177050000 59.99 50 TGGAGATGACTGCTTTGTGC Chr2:177049959..177049978 59.99 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000678627 Chr2:177056959..177057028 AATGTGTTTTGAGCGCCTCT Chr2:177057005..177057024 59.88 45
upstream ENSMUSE00000678632 Chr2:177051708..177051741 No primer for this exon
upstream ENSMUSE00000717291 Chr2:177051708..177051833 GGCTTTGCTGGATCCTTCTC Chr2:177051765..177051784 61.24 55
upstream ENSMUSE00000678631 Chr2:177051455..177051515 No primer for this exon
upstream ENSMUSE00000709498 Chr2:177049359..177050313 GCACAAAGCAGTCATCTCCA Chr2:177049981..177050000 59.99 50
upstream ENSMUSE00000714365 Chr2:177049359..177050313 GCACAAAGCAGTCATCTCCA Chr2:177049981..177050000 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTGCAGGCATGAAAGAAGTT Chr2:177050298..177050318 58.5 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGCAGGCATGAAAGAAGTT Chr2:177050298..177050318 58.5 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000078869