Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21564
Trapped Gene
Rb1cc1 (ENSMUSG00000025907)
Vector Insertion
Chr 1: 6205039 - 6218020
Public Clones E068G08 (ggtc) E068G08 (ggtc)
Private Clones OST325935 (lexicon) OST207571 (lexicon) OST117003 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000230540 (Chr1:6204743..6205038 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCGAGTCGACAATAACAAACC Chr1:6204743..6204763 59.49 47.62 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000230540 (Chr1:6204743..6205038 +)
Downstram Exon
ENSMUSE00000230531 (Chr1:6218021..6218130 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCGAGTCGACAATAACAAACC Chr1:6204743..6204763 59.49 47.62 ATTGGCAACTGAGTGGCATTA Chr1:6218061..6218081 60.52 42.86

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000230540 Chr1:6204743..6205038 CCGAGTCGACAATAACAAACC Chr1:6204743..6204763 59.49 47.62

*** Putative Vector Insertion (Chr 1: 6205039 - 6218020) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000230531 Chr1:6218021..6218130 ATTGGCAACTGAGTGGCATTA Chr1:6218061..6218081 60.52 42.86
downstream ENSMUSE00000475294 Chr1:6220040..6220154 CCTCACCCTCCAGTGTTGAT Chr1:6220063..6220082 59.96 55
downstream ENSMUSE00000230514 Chr1:6224042..6224168 CCCAGCGCTGTAAGTACACA Chr1:6224168..6224187 59.93 55
downstream ENSMUSE00000473285 Chr1:6224310..6224480 CAGGTGCACGGTCACATAAG Chr1:6224370..6224389 60.17 55
downstream ENSMUSE00000154068 Chr1:6228343..6228545 ATCATGGACAAGCCCTTCAC Chr1:6228402..6228421 59.93 50
downstream ENSMUSE00000154069 Chr1:6230033..6230459 TGGAGCTACATGCTCCATTG Chr1:6230264..6230283 59.82 50
downstream ENSMUSE00000154081 Chr1:6234186..6234356 CAAGGCATACAGCCGATCTT Chr1:6234302..6234321 60.24 50
downstream ENSMUSE00000154073 Chr1:6234876..6235060 CTGACGTGGAGATTGTTTGC Chr1:6235057..6235076 59.29 50
downstream ENSMUSE00000154083 Chr1:6235239..6235425 AGTGCCTGCAGTTTTTCTCC Chr1:6235298..6235317 59.48 50
downstream ENSMUSE00000154078 Chr1:6235506..6235587 TCCCAAAGGATTCCCTTTTT Chr1:6235581..6235600 59.75 40
downstream ENSMUSE00000154080 Chr1:6235679..6235740 AAATGAGGAAGGCCAGGAGT Chr1:6235740..6235759 60.07 50
downstream ENSMUSE00000154074 Chr1:6237787..6237890 TGAGGAATGGCTGCACTTCT Chr1:6237892..6237911 60.94 50
downstream ENSMUSE00000154076 Chr1:6238147..6238273 GGGCAAGTACATGCTGGTGT Chr1:6238199..6238218 60.99 55
downstream ENSMUSE00000154084 Chr1:6238357..6240248 ACTGCCGGACATAAGGTGTC Chr1:6238490..6238509 60 55
downstream ENSMUSE00000154086 Chr1:6251011..6251176 CTGCTGCTCAGCAATCAAAG Chr1:6251179..6251198 59.89 50
downstream ENSMUSE00000154089 Chr1:6252915..6253023 GCTCTTGCTGCTGCATTGTA Chr1:6253017..6253036 60.31 50
downstream ENSMUSE00000154088 Chr1:6253105..6253345 CATTGCGGAATCCAGTCTTC Chr1:6253325..6253344 60.6 50
downstream ENSMUSE00000154087 Chr1:6254623..6254671 No primer for this exon
downstream ENSMUSE00000154070 Chr1:6255655..6255702 No primer for this exon
downstream ENSMUSE00000154077 Chr1:6258779..6258837 TGCCTTGAAGAGACTGAGGAC Chr1:6258815..6258835 59.59 52.38
downstream ENSMUSE00000154071 Chr1:6260772..6260908 CCAAATCTCCCACCTGAAAA Chr1:6260794..6260813 59.9 45
downstream ENSMUSE00000154072 Chr1:6262782..6262852 No primer for this exon
downstream ENSMUSE00000495489 Chr1:6264279..6265656 TTTCCCAGAAATCACGCAAT Chr1:6265306..6265325 60.45 40

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTAATCGCCTTGCAGCACATC Chr1:6205089..6205110 63.08 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACATTACGTGACTGGGAAAACC Chr1:6208084..6208106 60.15 45.46 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000025907