Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21574
Trapped Gene
Zfp87 (ENSMUSG00000071285)
Vector Insertion
Chr 13: 67622256 - 67627012
Public Clones not available
Private Clones OST325558 (lexicon) OST171529 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000706167 (Chr13:67627013..67627084 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGTTAGCGGTGCTGTGTCC Chr13:67627048..67627067 60.32 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000706167 (Chr13:67627013..67627084 -)
Downstram Exon
ENSMUSE00000608587 (Chr13:67622129..67622255 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGTTAGCGGTGCTGTGTCC Chr13:67627048..67627067 60.32 55 CAGAGAAATCAATGGCCACA Chr13:67622194..67622213 59.65 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000706167 Chr13:67627013..67627084 AAGTTAGCGGTGCTGTGTCC Chr13:67627048..67627067 60.32 55

*** Putative Vector Insertion (Chr 13: 67622256 - 67627012) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000608587 Chr13:67622129..67622255 CAGAGAAATCAATGGCCACA Chr13:67622194..67622213 59.65 45
downstream ENSMUSE00000483574 Chr13:67621562..67621657 TTGCTCCAGAAATGTGACCA Chr13:67621592..67621611 60.24 45
downstream ENSMUSE00000497809 Chr13:67616720..67619048 GTGCCGAATGAGGTACGAAT Chr13:67618203..67618222 59.96 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCAGGGGAGTGGTCCTAATC Chr13:67626956..67626976 60.85 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCTGCCGTATCCTTTTCAGG Chr13:67626963..67626983 60.21 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000071285