Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21578
Trapped Gene
Aven (ENSMUSG00000003604)
Vector Insertion
Chr 2: 112399945 - 112465311
Public Clones not available
Private Clones OST325438 (lexicon) OST35347 (lexicon)
Severity of mutation (?) Insertion after 40% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000686189 (Chr2:112399911..112399944 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000686189 (Chr2:112399911..112399944 +)
Downstram Exon
ENSMUSE00000166341 (Chr2:112465312..112465382 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000362311 Chr2:112333121..112333378 No primer for this exon
upstream ENSMUSE00000311948 Chr2:112354607..112354784 No primer for this exon
upstream ENSMUSE00000686189 Chr2:112399911..112399944 No primer for this exon

*** Putative Vector Insertion (Chr 2: 112399945 - 112465311) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000166341 Chr2:112465312..112465382 No primer for this exon
downstream ENSMUSE00000166338 Chr2:112467906..112468001 No primer for this exon
downstream ENSMUSE00000166339 Chr2:112469897..112470233 No primer for this exon
downstream ENSMUSE00000642572 Chr2:112470936..112471227 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr2:112435995..112436015 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTACGTGACTGGGAAAACC Chr2:112432992..112433012 59.45 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000003604