Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21604
Trapped Gene
Fez1 (ENSMUSG00000032118)
Vector Insertion
Chr 9: 36683948 - 36686150
Public Clones not available
Private Clones OST324474 (lexicon)
Severity of mutation (?) Insertion after 99% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000411250 (Chr9:36683882..36683947 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCCATGAAGGAGGATAACGA Chr9:36683890..36683909 60.04 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000411250 (Chr9:36683882..36683947 +)
Downstram Exon
ENSMUSE00000701629 (Chr9:36686151..36686505 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCCATGAAGGAGGATAACGA Chr9:36683890..36683909 60.04 50 GAGGCTGCTCCAAAGATGAG Chr9:36686191..36686210 60.1 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000637917 Chr9:36640394..36640496 CACCTCTAGTCGGTGGTTGG Chr9:36640425..36640444 60.56 60
upstream ENSMUSE00000360008 Chr9:36651247..36651602 AGCTTCAAGTCCATGGAGGA Chr9:36651454..36651473 59.8 50
upstream ENSMUSE00000226569 Chr9:36657932..36658031 GGACCCAAACATTGAAGCTC Chr9:36657986..36658005 59.53 50
upstream ENSMUSE00000226546 Chr9:36668397..36668483 AGCCTCTCCTCACAGCTGAC Chr9:36668461..36668480 59.74 60
upstream ENSMUSE00000216694 Chr9:36671082..36671250 CAGGCAGATTCAGTCCTGCT Chr9:36671178..36671197 60.56 55
upstream ENSMUSE00000216708 Chr9:36675281..36675552 CTTCATCACGGTGCTCATTG Chr9:36675420..36675439 60.26 50
upstream ENSMUSE00000216705 Chr9:36676433..36676513 ATGGAAGGCATCTCCAACAT Chr9:36676442..36676461 59.37 45
upstream ENSMUSE00000584724 Chr9:36678066..36678141 TCTCCTCCCTCTGTGGAAGA Chr9:36678102..36678121 59.91 55
upstream ENSMUSE00000411250 Chr9:36683882..36683947 GCCATGAAGGAGGATAACGA Chr9:36683890..36683909 60.04 50

*** Putative Vector Insertion (Chr 9: 36683948 - 36686150) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000701629 Chr9:36686151..36686505 GAGGCTGCTCCAAAGATGAG Chr9:36686191..36686210 60.1 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGAGAAGGTGCCTACTTTGC Chr9:36683908..36683928 60.01 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGAGAAGGTGCCTACTTTGC Chr9:36683908..36683928 60.01 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032118