Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21606
Trapped Gene
Vat1 (ENSMUSG00000034993)
Vector Insertion
Chr 11: 101324431 - 101327021
Public Clones IST11386G2 (tigm)
Private Clones OST324184 (lexicon)
Severity of mutation (?) Insertion after 35% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000375873 (Chr11:101327022..101327455 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTTCGGTGGCTACGATAAG Chr11:101327226..101327245 59.87 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000375873 (Chr11:101327022..101327455 -)
Downstram Exon
ENSMUSE00000240558 (Chr11:101324223..101324430 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTTCGGTGGCTACGATAAG Chr11:101327226..101327245 59.87 55 CAGCCATGTGTACCAAGACG Chr11:101324204..101324223 60.17 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000375873 Chr11:101327022..101327455 GCTTCGGTGGCTACGATAAG Chr11:101327226..101327245 59.87 55

*** Putative Vector Insertion (Chr 11: 101324431 - 101327021) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000240558 Chr11:101324223..101324430 CAGCCATGTGTACCAAGACG Chr11:101324204..101324223 60.17 55
downstream ENSMUSE00000378248 Chr11:101323704..101323874 GTAGTCGATGGGGTGTGTGA Chr11:101323728..101323747 59.39 55
downstream ENSMUSE00000332719 Chr11:101323512..101323601 GAGGGTCCATGACGATGTCT Chr11:101323556..101323575 59.93 55
downstream ENSMUSE00000404526 Chr11:101321691..101321932 CACGCTATTGACGAGTTCCA Chr11:101321744..101321763 59.86 50
downstream ENSMUSE00000355051 Chr11:101320053..101321590 CAAACTCAAGCCGGAAGAAG Chr11:101320881..101320900 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGTAAGGTGAGCGGTAGCAG Chr11:101327006..101327026 60.97 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGTAAGGTGAGCGGTAGCAG Chr11:101327006..101327026 60.97 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GGCACCTGTGGGTAAATGAA Chr11:101327468..101327488 60.76 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GGCACCTGTGGGTAAATGAA Chr11:101327468..101327488 60.76 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000034993